MBD1 (NM_015847) Human Untagged Clone
CAT#: SC313991
MBD1 (untagged)-Human methyl-CpG binding domain protein 1 (MBD1), transcript variant 5
"NM_015847" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MBD1 |
Synonyms | CXXC3; PCM1; RFT |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_015847, the custom clone sequence may differ by one or more nucleotides
ATGGCTGAGGACTGGCTGGACTGCCCGGCCCTGGGCCCTGGCTGGAAGCGCCGCGAAGTCTTTCGCAAGT CAGGGGCCACCTGTGGACGCTCAGACACCTATTACCAGAGCCCCACAGGAGACAGGATCCGAAGCAAAGT TGAGCTGACTCGATACCTGGGCCCTGCGTGTGATCTCACCCTCTTCGACTTCAAACAAGGCATCTTGTGC TATCCAGCCCCCAAGGCCCATCCCGTGGCGGTTGCCAGCAAGAAGCGAAAGAAGCCTTCAAGGCCAGCCA AGACTCGGAAACGTCAGGTTGGACCCCAGAGTGGTGAGGTCAGGAAGGAGGCCCCGAGGGATGAGACCAA GGCTGACACTGACACAGCCCCAGCTTCATTCCCTGCTCCTGGGTGCTGTGAGAACTGTGGAATCAGCTTC TCAGGGGATGGCACCCAAAGGCAGCGGCTCAAAACGTTGTGCAAAGACTGTCGAGCACAGAGAATTGCCT TCAACCGGGAACAGAGAATGTTTAAGAGCCGAGGGTGTGGAGTATGCCGGGGCTGTCAGACCCAAGAGGA TTGTGGCCATTGCCCCATCTGCCTTCGCCCTCCCCGCCCTGGTCTCAGGCGCCAGTGGAAATGTGTCCAG CGACGTTGCCTACGGGGTAAACATGCCCGCCGCAAGGGAGGCTGTGACTCCAAGATGGCTGCCAGGCGGC GCCCCGGAGCCCAGCCACTGCCTCCACCACCCCCATCACAGTCCCCAGAGCCCACAGAGCCGCACCCCAG AGCCCTGGCCCCCTCGCCACCTGCCGAGTTCATCTATTACTGTGTAGACGAGGACGAGCTACAGCCCTAC ACGAACCGCCGGCAGAACCGCAAGTGCGGGGCCTGTGCAGCCTGCCTACGGCGGATGGACTGTGGCCGCT GCGACTTCTGCTGCGACAAGCCCAAATTCGGGGGCAGCAACCAGAAGCGCCAGAAGTGTCGTTGGCGCCA ATGCCTGCAGTTTGCCATGAAGCGGCTGCTGCCCAGTGTCTGGTCAGAGTCTGAGGATGGGGCAGGATCG CCCCCACCTTACCGTCGTCGAAAGAGGCCCAGCTCTGCCCGACGGCACCATCTTGGCCCTACCTTGAAGC CCACCTTGGCTACACGCACAGCCCAACCAGACCATACCCAGGCTCCAACGAAGCAGGAAGCAGGTGGTGG CTTTGTGCTGCCCCCGCCTGGCACTGACCTTGTGTTTTTACGGGAAGGCGCAAGCAGTCCTGTGCAGGTG CCGGGCCCTGTTGCAGCTTCCACAGAAGCCCTGTTGCAGGAGGCCCAGTGCTCTGGCCTGAGTTGGGTTG TGGCCTTACCCCAGGTGAAGCAAGAGAAGGCGGATACCCAGGACGAGTGGACACCAGGCACAGCTGTCCT GACTTCTCCCGTATTGGTGCCTGGCTGCCCTAGCAAGGCAGTAGACCCAGGCCTGCCTTCTGTGAAGCAA GAGCCACCTGACCCAGAGGAGGACAAGGAGGAGAACAAGGATGATTCTGCCTCCAAATTGGCCCCAGAGG AAGAGGCAGGAGGGGCTGGCACACCCGTGATCACGGAGATTTTCAGCCTGGGTGGAACCCGCTTCCGAGA TACAGCAGTCTGGTTGCCAAGGTCCAAAGACCTTAAAAAACCTGGAGCTAGAAAGCAGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_015847 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_015847.3, NP_056723.2 |
RefSeq Size | 3137 bp |
RefSeq ORF | 1671 bp |
Locus ID | 4152 |
Cytogenetics | 18q21.1 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | 'The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains multiple domains: MBD at the N-terminus that functions both in binding to methylated DNA and in protein interactions; several CXXC-type zinc finger domains that mediate binding to non-methylated CpG dinucleotides; transcriptional repression domain (TRD) at the C-terminus that is involved in transcription repression and in protein interactions. Numerous alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Feb 2011]' Transcript Variant: This variant (5) lacks an in-frame coding exon compared to variant 1, resulting in a shorter isoform (5) missing an internal protein segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224185 | MBD1 (Myc-DDK-tagged)-Human methyl-CpG binding domain protein 1 (MBD1), transcript variant 5 |
USD 480.00 |
|
RG224185 | MBD1 (GFP-tagged) - Human methyl-CpG binding domain protein 1 (MBD1), transcript variant 5 |
USD 530.00 |
|
RC224185L3 | Lenti-ORF clone of MBD1 (Myc-DDK-tagged)-Human methyl-CpG binding domain protein 1 (MBD1), transcript variant 5 |
USD 680.00 |
|
RC224185L4 | Lenti-ORF clone of MBD1 (mGFP-tagged)-Human methyl-CpG binding domain protein 1 (MBD1), transcript variant 5 |
USD 680.00 |
{0} Product Review(s)
Be the first one to submit a review