YY1 associated factor 2 (YAF2) (NM_005748) Human Untagged Clone

CAT#: SC315481

YAF2 (untagged)-Human YY1 associated factor 2 (YAF2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: YAF2
• Synonyms: DKFZp779H1820; MGC41856
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_005748, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGAGACAAGAAGAGCCCCACCAGGCCGAAGCGGCAGCCGAAGCCGTCCTCGGATGAGGGTTACTGGG
  ACTGTAGCGTCTGCACCTTCCGGAACAGCGCCGAGGCCTTCAAGTGCATGATGTGCGATGTGCGGAAGGG
  CACCTCCACCCGGAAACCTCGACCTGTCTCCCAGTTGGTTGCACAGCAGGTTACTCAGCAGTTTGTGCCT
  CCTACACAGTCAAAGAAAGAGAAAAAAGATAAAGTAGAAAAAGAAAAAAGTGAAAAGGAAACAACTAGCA
  AAAAGAATAGCCATAAGAAAACCAGGCCAAGATTGAAAAATGTGGATCGGAGTAGTGCTCAGCATTTGGA
  AGTTACTGTTGGAGATCTGACAGTCATTATTACAGACTTTAAGGAGAAAACAAAGTCACCGCCTGCATCT
  AGTGCTGCTTCTGCAGATCAACACAGTCAAAGCGGCTCTAGCTCTGATAACACAGAGAGAGGAATGTCCA
  GGTCATCTTCACCCAGAGGAGAAGCCTCATCATTGAATGGAGAATCTCATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_005748
• ORF Size: 543 bp
• Insert Size: 0
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_005748.5, NP_005739.2
• RefSeq Size: 4225
• RefSeq ORF: 543
• Locus ID: 10138
• Domains: zf-RanBP
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: This gene encodes a zinc finger containing protein that functions in the regulation of transcription. This protein was identified as an interacting partner of transcriptional repressor protein Yy1, and also interacts with other transcriptional regulators, including Myc and Polycomb. This protein can promote proteolysis of Yy1. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Feb 2016]
  Transcript Variant: This variant (2) lacks an in-frame exon compared to variant 1. The resulting isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.