YY1 associated factor 2 (YAF2) (NM_005748) Human Untagged Clone
CAT#: SC315481
YAF2 (untagged)-Human YY1 associated factor 2 (YAF2), transcript variant 2
"NM_005748" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | YAF2 |
Synonyms | DKFZp779H1820; MGC41856 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_005748, the custom clone sequence may differ by one or more nucleotides
ATGGGAGACAAGAAGAGCCCCACCAGGCCGAAGCGGCAGCCGAAGCCGTCCTCGGATGAGGGTTACTGGG ACTGTAGCGTCTGCACCTTCCGGAACAGCGCCGAGGCCTTCAAGTGCATGATGTGCGATGTGCGGAAGGG CACCTCCACCCGGAAACCTCGACCTGTCTCCCAGTTGGTTGCACAGCAGGTTACTCAGCAGTTTGTGCCT CCTACACAGTCAAAGAAAGAGAAAAAAGATAAAGTAGAAAAAGAAAAAAGTGAAAAGGAAACAACTAGCA AAAAGAATAGCCATAAGAAAACCAGGCCAAGATTGAAAAATGTGGATCGGAGTAGTGCTCAGCATTTGGA AGTTACTGTTGGAGATCTGACAGTCATTATTACAGACTTTAAGGAGAAAACAAAGTCACCGCCTGCATCT AGTGCTGCTTCTGCAGATCAACACAGTCAAAGCGGCTCTAGCTCTGATAACACAGAGAGAGGAATGTCCA GGTCATCTTCACCCAGAGGAGAAGCCTCATCATTGAATGGAGAATCTCATTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_005748 |
ORF Size | 543 bp |
Insert Size | 0 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_005748.5, NP_005739.2 |
RefSeq Size | 4225 |
RefSeq ORF | 543 |
Locus ID | 10138 |
Domains | zf-RanBP |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene encodes a zinc finger containing protein that functions in the regulation of transcription. This protein was identified as an interacting partner of transcriptional repressor protein Yy1, and also interacts with other transcriptional regulators, including Myc and Polycomb. This protein can promote proteolysis of Yy1. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (2) lacks an in-frame exon compared to variant 1. The resulting isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214071 | YAF2 (Myc-DDK-tagged)-Human YY1 associated factor 2 (YAF2), transcript variant 2 |
USD 98.00 |
|
RG214071 | YAF2 (GFP-tagged) - Human YY1 associated factor 2 (YAF2), transcript variant 2 |
USD 460.00 |
|
RC214071L1 | Lenti ORF clone of Human YY1 associated factor 2 (YAF2), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC214071L2 | Lenti ORF clone of Human YY1 associated factor 2 (YAF2), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC214071L3 | Lenti ORF clone of Human YY1 associated factor 2 (YAF2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC214071L4 | Lenti ORF clone of Human YY1 associated factor 2 (YAF2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review