ART5 (NM_001079536) Human Untagged Clone
CAT#: SC315510
ART5 (untagged)-Human ADP-ribosyltransferase 5 (ART5), transcript variant 2
"NM_001079536" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ART5 |
Synonyms | ARTC5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001079536, the custom clone sequence may differ by one or more nucleotides
ATGGCGCTGGCGGCTTTGATGATCGCCCTCGGCAGCCTCGGCCTCCACACCTGGCAGGCCCAGGCTGTTC CCATCCTGCCCCTGGGCCTGGCTCCAGACACCTTTGACGATACCTATGTGGGTTGTGCAGAGGAGATGGA GGAGAAGGCAGCCCCCCTGCTAAAGGAGGAAATGGCCCACCATGCCCTGCTGCGGGAATCCTGGGAGGCA GCCCAGGAGACCTGGGAGGACAAGCGTCGAGGGCTTACCTTGCCCCCTGGCTTCAAAGCCCAGAATGGAA TAGCCATTATGGTCTACACCAACTCATCGAACACCTTGTACTGGGAGTTGAATCAGGCCGTGCGGACGGG CGGAGGCTCCCGGGAGCTCTACATGAGGCACTTTCCCTTCAAGGCCCTGCATTTCTACCTGATCCGGGCC CTGCAGCTGCTGCGAGGCAGTGGGGGCTGCAGCAGGGGACCTGGGGAGGTGGTGTTCCGAGGTGTGGGCA GCCTTCGCTTTGAACCCAAGAGGCTGGGAGACTCTGTCCGCTTGGGCCAGTTTGCCTCCAGCTCCCTGGA TAAGGCAGTGGCCCACAGATTTGGTAATGCCACCCTCTTCTCTCTAACAACTTGCTTTGGGGCCCCTATA CAGGCCTTCTCTGTCTTTCCCAAGGAGCGCGAGGTGCTGATTCCCCCCCATGAAGTCTTTTTGGTTACCA GATTCTCTCAGGATGGAGCCCAGAGCTTGGTGACTCTCTGGAGCTATAATCAGACCTGTAGCCATTTTAA CTGCGCCTATCTGGGTGGGGAGAAGAGGCGGGGCTGTGTGTCTGCGCCAGGAGCCCTGGGAACGGGTGAC CTTCATATGACGAAGAGGCACCTCCAGCAGCCTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001079536 |
ORF Size | 876 bp |
Insert Size | 0 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001079536.1, NP_001073004.1 |
RefSeq Size | 1249 |
RefSeq ORF | 876 |
Locus ID | 116969 |
Protein Families | Secreted Protein |
Gene Summary | The protein encoded by this gene belongs to the ARG-specific ADP-ribosyltransferase family. Proteins in this family regulate the function of target proteins by attaching ADP-ribose to specific amino acid residues in their target proteins. The mouse homolog lacks a glycosylphosphatidylinositol-anchor signal sequence and is predicted to be a secretory enzyme. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (2) contains a different 5' UTR compared to transcript variant 1. Variants 1 and 2 both encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221774 | ART5 (Myc-DDK-tagged)-Human ADP-ribosyltransferase 5 (ART5), transcript variant 2 |
USD 420.00 |
|
RG221774 | ART5 (GFP-tagged) - Human ADP-ribosyltransferase 5 (ART5), transcript variant 2 |
USD 460.00 |
|
RC221774L3 | Lenti ORF clone of Human ADP-ribosyltransferase 5 (ART5), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC221774L4 | Lenti ORF clone of Human ADP-ribosyltransferase 5 (ART5), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review