ART5 (NM_001079536) Human Untagged Clone

CAT#: SC315510

ART5 (untagged)-Human ADP-ribosyltransferase 5 (ART5), transcript variant 2


  "NM_001079536" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ART5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ART5
Synonyms ARTC5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001079536, the custom clone sequence may differ by one or more nucleotides


ATGGCGCTGGCGGCTTTGATGATCGCCCTCGGCAGCCTCGGCCTCCACACCTGGCAGGCCCAGGCTGTTC
CCATCCTGCCCCTGGGCCTGGCTCCAGACACCTTTGACGATACCTATGTGGGTTGTGCAGAGGAGATGGA
GGAGAAGGCAGCCCCCCTGCTAAAGGAGGAAATGGCCCACCATGCCCTGCTGCGGGAATCCTGGGAGGCA
GCCCAGGAGACCTGGGAGGACAAGCGTCGAGGGCTTACCTTGCCCCCTGGCTTCAAAGCCCAGAATGGAA
TAGCCATTATGGTCTACACCAACTCATCGAACACCTTGTACTGGGAGTTGAATCAGGCCGTGCGGACGGG
CGGAGGCTCCCGGGAGCTCTACATGAGGCACTTTCCCTTCAAGGCCCTGCATTTCTACCTGATCCGGGCC
CTGCAGCTGCTGCGAGGCAGTGGGGGCTGCAGCAGGGGACCTGGGGAGGTGGTGTTCCGAGGTGTGGGCA
GCCTTCGCTTTGAACCCAAGAGGCTGGGAGACTCTGTCCGCTTGGGCCAGTTTGCCTCCAGCTCCCTGGA
TAAGGCAGTGGCCCACAGATTTGGTAATGCCACCCTCTTCTCTCTAACAACTTGCTTTGGGGCCCCTATA
CAGGCCTTCTCTGTCTTTCCCAAGGAGCGCGAGGTGCTGATTCCCCCCCATGAAGTCTTTTTGGTTACCA
GATTCTCTCAGGATGGAGCCCAGAGCTTGGTGACTCTCTGGAGCTATAATCAGACCTGTAGCCATTTTAA
CTGCGCCTATCTGGGTGGGGAGAAGAGGCGGGGCTGTGTGTCTGCGCCAGGAGCCCTGGGAACGGGTGAC
CTTCATATGACGAAGAGGCACCTCCAGCAGCCTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001079536
ORF Size 876 bp
Insert Size 0
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001079536.1, NP_001073004.1
RefSeq Size 1249
RefSeq ORF 876
Locus ID 116969
Protein Families Secreted Protein
Gene Summary The protein encoded by this gene belongs to the ARG-specific ADP-ribosyltransferase family. Proteins in this family regulate the function of target proteins by attaching ADP-ribose to specific amino acid residues in their target proteins. The mouse homolog lacks a glycosylphosphatidylinositol-anchor signal sequence and is predicted to be a secretory enzyme. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (2) contains a different 5' UTR compared to transcript variant 1. Variants 1 and 2 both encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.