Constitutive androstane receptor (NR1I3) (NM_001077472) Human Untagged Clone

CAT#: SC315528

NR1I3 (untagged)-Human nuclear receptor subfamily 1, group I, member 3 (NR1I3), transcript variant 9

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NR1I3
• Synonyms: CAR; CAR1; MB67
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001077472, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGCCTAAGAGAAGCAGGAGAACAGTCAGCAAAAGCATTGGTCCCACCTGCCCCTTTGCTGGAAGCT
  GTGAAGTCAGCAAGACTCAGAGGCGCCACTGCCCAGCCTGCAGGTTGCAGAAGTGCTTAGATGCTGGCAT
  GAGGAAAGACATGATACTGTCGGCAGAAGCCCTGGCATTGCGGCGAGCAAAGCAGGCCCAGCGGCGGGCA
  CAGCAAACACCTGTGCAACTGAGTAAGGAGCAAGAAGAGCTGATCCGGACACTCCTGGGGGCCCACACCC
  GCCACATGGGCACCATGTTTGAACAGTTTGTGCAGTTTAGGCCTCCAGCTCATCTGTTCATCCATCACCA
  GCCCTTGCCCACCCTGGCCCCTGTGCTGCCTCTGGTCACACACTTCGCAGACATCAACACTTTCATGGTA
  CTGCAAGTCATCAAGTTTACTAAGGACCTGCCCGTCTTCCGTTCCCTGCCCATTGAAGACCAGATCTCCC
  TTCTCAAGGGAGCAGCTGTGGAAATCTGTCACATCGTACTCAATACCACTTTCTGTCTCCAAACACAAAA
  CTTCCTCTGCGGGCCTCTTCGCTACACAATTGAAGATGGAGCCCGTGTGGGGTTCCAGGTAGAGTTTTTG
  GAGTTGCTCTTTCACTTCCATGGAACACTACGAAAACTGCAGCTCCAAGAGCCTGAGTATGTGCTCTTGG
  CTGCCATGGCCCTCTTCTCTCCTGCTCCCTATCTTACAGACCGACCTGGAGTTACCCAGAGAGATGAGAT
  TGATCAGCTGCAAGAGGAGATGGCACTGACTCTGCAAAGCTACATCAAGGGCCAGCAGCGAAGGCCCCGG
  GATCGGTTTCTGTATGCGAAGTTGCTAGGCCTGCTGGCTGAGCTCCGGAGCATTAATGAGGCCTACGGGT
  ACCAAATCCAGCACATCCAGGGCCTGTCTGCCATGATGCCGCTGCTCCAGGAGATCTGCAGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001077472
• ORF Size: 975 bp
• Insert Size: 0
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001077472.2, NP_001070940.1
• RefSeq Size: 1262
• RefSeq ORF: 975
• Locus ID: 9970
• Protein Families: Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
• Gene Summary: This gene encodes a member of the nuclear receptor superfamily, and is a key regulator of xenobiotic and endobiotic metabolism. The protein binds to DNA as a monomer or a heterodimer with the retinoid X receptor and regulates the transcription of target genes involved in drug metabolism and bilirubin clearance, such as cytochrome P450 family members. Unlike most nuclear receptors, this transcriptional regulator is constitutively active in the absence of ligand but is regulated by both agonists and inverse agonists. Ligand binding results in translocation of this protein to the nucleus, where it activates or represses target gene transcription. These ligands include bilirubin, a variety of foreign compounds, steroid hormones, and prescription drugs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (9), also known as SV-6, lacks an alternate in-frame exon in the 5' coding region and uses an alternate splice site in the 3' coding region, compared to variant 1. The resulting protein (isoform 9) is shorter, uses an upstream start codon, and has a distinct N-terminus, compared to isoform 1.