PLAGL1 (NM_001080956) Human Untagged Clone

CAT#: SC315947

PLAGL1 (untagged)-Human pleiomorphic adenoma gene-like 1 (PLAGL1), transcript variant 8

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PLAGL1
• Synonyms: LOT1; ZAC; ZAC1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001080956, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTACCCATTCTCCCCAGAAATCTCACCAGTGTGCTCACTGTGAGAAGACGTTCAACCGGAAAGACC
  ACCTGAAAAACCACCTCCAGACCCACGACCCCAACAAAATGGCCTTTGGGTGTGAGGAGTGTGGGAAGAA
  GTACAACACCATGCTGGGCTATAAGAGGCACCTGGCCCTCCATGCGGCCAGCAGTGGGGACCTCACCTGT
  GGGGTCTGTGCCCTGGAGCTAGGGAGCACCGAGGTGCTACTGGACCACCTCAAAGCCCATGCGGAAGAGA
  AGCCCCCTAGCGGAACCAAGGAAAAGAAGCACCAGTGCGACCACTGTGAAAGATGCTTCTACACCCGGAA
  GGATGTGCGACGCCACCTGGTGGTCCACACAGGATGCAAGGACTTCCTGTGCCAGTTCTGTGCCCAGAGA
  TTTGGGCGCAAGGATCACCTCACCCGGCATACCAAGAAGACCCACTCACAGGAGCTGATGAAAGAGAGCT
  TGCAGACCGGAGACCTTCTGAGCACCTTCCACACCATCTCGCCTTCATTCCAACTGAAGGCTGCTGCCTT
  GCCTCCTTTCCCTTTAGGAGCTTCTGCCCAGAACGGGCTTGCAAGTAGCTTGCCAGCTGAGGTCCATAGC
  CTCACCCTCAGTCCCCCAGAACAAGCCGCCCAGCCTATGCAGCCGCTGCCAGAGTCCCTGGCCTCCCTCC
  ACCCCTCGGTATCCCCTGGCTCTCCTCCGCCACCCCTTCCCAATCACAAGTACAACACCACTTCTACCTC
  ATACTCCCCACTTGCAAGCCTGCCCCTCAAAGCAGATACTAAAGGTTTTTGCAATATCAGTTTGTTTGAG
  GACTTGCCTCTGCAAGAGCCTCAGTCACCTCAAAAGCTCAACCCAGGTTTTGATCTGGCTAAGGGAAATG
  CTGGTAAAGTAAACCTGCCCAAGGAGCTGCCTGCAGATGCTGTGAACCTAACAATACCTGCCTCTCTGGA
  CCTGTCCCCCCTGTTGGGCTTCTGGCAGCTGCCCCCTCCTGCTACCCAAAATACCTTTGGGAATAGCACT
  CTTGCCCTGGGGCCTGGGGAATCTTTGCCCCACAGGTTAAGCTGTCTGGGGCAGCAGCAGCAAGAACCCC
  CACTTGCCATGGGCACTGTGAGCCTGGGCCAGCTCCCCCTGCCCCCCATCCCTCATGTGTTCTCAGCTGG
  CACTGGCTCTGCCATCCTGCCTCATTTCCATCATGCATTCAGATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001080956
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001080956.2, NP_001074425.1
• RefSeq Size: 2929 bp
• RefSeq ORF: 1236 bp
• Locus ID: 5325
• Cytogenetics: 6q24.2
• Protein Families: Transcription Factors
• Gene Summary: 'This gene encodes a C2H2 zinc finger protein that functions as a suppressor of cell growth. This gene is often deleted or methylated and silenced in cancer cells. In addition, overexpression of this gene during fetal development is thought to be the causal factor for transient neonatal diabetes mellitus (TNDM). Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding two different protein isoforms. The P1 downstream promoter of this gene is imprinted, with preferential expression from the paternal allele in many tissues. [provided by RefSeq, Nov 2015]'
  Transcript Variant: This variant (8) initiates from the P1 promoter, differs in the 5' UTR and 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (1, also known as ZACdelta2) has a shorter N-terminus than isoform 2. Variants 7, 8, 9, 11, 13, 14, 21, 24, and 26 all encode the same isoform (1).