PLAGL1 (NM_001080954) Human Untagged Clone

CAT#: SC315957

PLAGL1 (untagged)-Human pleiomorphic adenoma gene-like 1 (PLAGL1), transcript variant 6


  "NM_001080954" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PLAGL1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PLAGL1
Synonyms LOT1; ZAC; ZAC1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001080954, the custom clone sequence may differ by one or more nucleotides
ATGGCCACGTTCCCCTGCCAGTTATGTGGCAAGACGTTCCTCACCCTGGAGAAGTTCACG
ATTCACAATTATTCCCACTCCAGGGAGCGGCCGTACAAGTGTGTGCAGCCTGACTGTGGC
AAAGCCTTTGTTTCCAGATATAAATTGATGAGGCATATGGCTACCCATTCTCCCCAGAAA
TCTCACCAGTGTGCTCACTGTGAGAAGACGTTCAACCGGAAAGACCACCTGAAAAACCAC
CTCCAGACCCACGACCCCAACAAAATGGCCTTTGGGTGTGAGGAGTGTGGGAAGAAGTAC
AACACCATGCTGGGCTATAAGAGGCACCTGGCCCTCCATGCGGCCAGCAGTGGGGACCTC
ACCTGTGGGGTCTGTGCCCTGGAGCTAGGGAGCACCGAGGTGCTACTGGACCACCTCAAA
GCCCATGCGGAAGAGAAGCCCCCTAGCGGAACCAAGGAAAAGAAGCACCAGTGCGACCAC
TGTGAAAGATGCTTCTACACCCGGAAGGATGTGCGACGCCACCTGGTGGTCCACACAGGA
TGCAAGGACTTCCTGTGCCAGTTCTGTGCCCAGAGATTTGGGCGCAAGGATCACCTCACC
CGGCATACCAAGAAGACCCACTCACAGGAGCTGATGAAAGAGAGCTTGCAGACCGGAGAC
CTTCTGAGCACCTTCCACACCATCTCGCCTTCATTCCAACTGAAGGCTGCTGCCTTGCCT
CCTTTCCCTTTAGGAGCTTCTGCCCAGAACGGGCTTGCAAGTAGCTTGCCAGCTGAGGTC
CATAGCCTCACCCTCAGTCCCCCAGAACAAGCCGCCCAGCCTATGCAGCCGCTGCCAGAG
TCCCTGGCCTCCCTCCACCCCTCGGTATCCCCTGGCTCTCCTCCGCCACCCCTTCCCAAT
CACAAGTACAACACCACTTCTACCTCATACTCCCCACTTGCAAGCCTGCCCCTCAAAGCA
GATACTAAAGGTTTTTGCAATATCAGTTTGTTTGAGGACTTGCCTCTGCAAGAGCCTCAG
TCACCTCAAAAGCTCAACCCAGGTTTTGATCTGGCTAAGGGAAATGCTGGTAAAGTAAAC
CTGCCCAAGGAGCTGCCTGCAGATGCTGTGAACCTAACAATACCTGCCTCTCTGGACCTG
TCCCCCCTGTTGGGCTTCTGGCAGCTGCCCCCTCCTGCTACCCAAAATACCTTTGGGAAT
AGCACTCTTGCCCTGGGGCCTGGGGAATCTTTGCCCCACAGGTTAAGCTGTCTGGGGCAG
CAGCAGCAAGAACCCCCACTTGCCATGGGCACTGTGAGCCTGGGCCAGCTCCCCCTGCCC
CCCATCCCTCATGTGTTCTCAGCTGGCACTGGCTCTGCCATCCTGCCTCATTTCCATCAT
GCATTCAGA
Restriction Sites Please inquire     
ACCN NM_001080954
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001080954.1, NP_001074423.1
RefSeq Size 3378 bp
RefSeq ORF 1392 bp
Locus ID 5325
Cytogenetics 6q24.2
Protein Families Transcription Factors
Gene Summary 'This gene encodes a C2H2 zinc finger protein that functions as a suppressor of cell growth. This gene is often deleted or methylated and silenced in cancer cells. In addition, overexpression of this gene during fetal development is thought to be the causal factor for transient neonatal diabetes mellitus (TNDM). Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding two different protein isoforms. The P1 downstream promoter of this gene is imprinted, with preferential expression from the paternal allele in many tissues. [provided by RefSeq, Nov 2015]'
Transcript Variant: This variant (6, also known as P1D) initiates from the P1 promoter and differs in the 5' UTR compared to variant 2. Variants 2, 3, 4, 5, 6, 10, 12, 15, 16, 17, 18, 19, 20, 22, 23, 25, 27, and 28 all encode the same isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.