TAFA5 (NM_001082967) Human Untagged Clone
CAT#: SC315980
FAM19A5 (untagged)-Human family with sequence similarity 19 (chemokine (C-C motif)-like), member A5 (FAM19A5), transcript variant 1
"NM_001082967" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TAFA5 |
Synonyms | FAM19A5; QLLK5208; TAFA-5; UNQ5208 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001082967, the custom clone sequence may differ by one or more nucleotides
ATGGCGCCATCGCCCAGGACCGGCAGCCGGCAAGATGCGACCGCCCTGCCCAGCATGTCC TCAACTTTCTGGGCGTTCATGATCCTGGCCAGCCTGCTCATCGCCTACTGCAGTCAGCTG GCCGCCGGCACCTGTGAGATTGTGACCTTGGACCGGGACAGCAGCCAGCCTCGGAGGACG ATCGCCCGGCAGACCGCCCGCTGTGCGTGTAGAAAGGGGCAGATCGCCGGCACCACGAGA GCCCGGCCCGCCTGTGTGGACGCAAGAATCATCAAGACCAAGCAGTGGTGTGACATGCTT CCGTGTCTGGAGGGGGAAGGCTGCGACTTGTTAATCAACCGGTCAGGCTGGACGTGCACG CAGCCCGGCGGGAGGATAAAGACCACCACGGTCTCC |
Restriction Sites | Please inquire |
ACCN | NM_001082967 |
ORF Size | 399 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001082967.1, NP_001076436.1 |
RefSeq Size | 2615 |
RefSeq ORF | 399 |
Locus ID | 25817 |
Protein Families | Secreted Protein, Transmembrane |
Gene Summary | This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines that act as regulators of immune and nervous cells. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (1) represents the shorter transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC207405 | FAM19A5 (Myc-DDK-tagged)-Human family with sequence similarity 19 (chemokine (C-C motif)-like), member A5 (FAM19A5), transcript variant 1 |
USD 420.00 |
|
RG207405 | FAM19A5 (GFP-tagged) - Human family with sequence similarity 19 (chemokine (C-C motif)-like), member A5 (FAM19A5), transcript variant 1 |
USD 460.00 |
|
RC207405L3 | Lenti-ORF clone of FAM19A5 (Myc-DDK-tagged)-Human family with sequence similarity 19 (chemokine (C-C motif)-like), member A5 (FAM19A5), transcript variant 1 |
USD 620.00 |
|
RC207405L4 | Lenti-ORF clone of FAM19A5 (mGFP-tagged)-Human family with sequence similarity 19 (chemokine (C-C motif)-like), member A5 (FAM19A5), transcript variant 1 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review