G6PC2 (NM_001081686) Human Untagged Clone

CAT#: SC315981

G6PC2 (untagged)-Human glucose-6-phosphatase, catalytic, 2 (G6PC2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: G6PC2
• Synonyms: IGRP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001081686, the custom clone sequence may differ by one or more nucleotides
  ATGGATTTCCTTCACAGGAATGGAGTGCTCATAATTCAGCATTTGCAGAAGGACTACCGA
  GCTTACTACACTTTTCTAAATTTTATGTCCAATGTTGGAGACCCCAGGAATATCTTTTTC
  ATTTATTTTCCACTTTGTTTTCAATTTAATCAGACAGTTGGAACCAAGATGATATGGGTA
  GCAGTCATTGGGGATTGGTTAAATCTTATATTTAAATGGATATTATTTGGTCATCGACCT
  TACTGGTGGGTCCAAGAAACTCAGATTTACCCAAATCACTCAAGTCCATGCCTTGAACAG
  TTCCCTACTACATGTGAAACAGGTCCAGGAAGTCCATCTGGCCATGCAATGGGCGCATCC
  TGTGTCTGGTATGTCATGGTAACCGCTGCCCTGAGCCACACTGTCTGTGGGATGGATAAG
  TTCTCTATCACTCTGCACAGGCATGCTGGTGGCAGAGGCCTT
  
• Restriction Sites: Please inquire
• ACCN: NM_001081686
• ORF Size: 465 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001081686.1, NP_001075155.1
• RefSeq Size: 2980
• RefSeq ORF: 465
• Locus ID: 57818
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Adipocytokine signaling pathway, Galactose metabolism, Glycolysis / Gluconeogenesis, Insulin signaling pathway, Metabolic pathways, Starch and sucrose metabolism
• Gene Summary: This gene encodes an enzyme belonging to the glucose-6-phosphatase catalytic subunit family. These enzymes are part of a multicomponent integral membrane system that catalyzes the hydrolysis of glucose-6-phosphate, the terminal step in gluconeogenic and glycogenolytic pathways, allowing the release of glucose into the bloodstream. The family member encoded by this gene is found in pancreatic islets and does not exhibit phosphohydrolase activity, but it is a major target of cell-mediated autoimmunity in diabetes. Several alternatively spliced transcript variants of this gene have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1.