RBFOX2 (NM_001082576) Human Untagged Clone

CAT#: SC315997

RBFOX2 (untagged)-Human RNA binding protein, fox-1 homolog (C. elegans) 2 (RBFOX2), transcript variant 3


  "NM_001082576" in other vectors (4)

Reconstitution Protocol

USD 650.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RBFOX2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RBFOX2
Synonyms dJ106I20.3; Fox-2; FOX2; fxh; HNRBP2; HRNBP2; RBM9; RTA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001082576, the custom clone sequence may differ by one or more nucleotides


ATGGAGAAAAAGAAAATGGTAACTCAGGGTAACCAGGAGCCGACAACAACTCCTGACGCAATGGTTCAGC
CTTTTACTACCATCCCATTTCCACCACCTCCGCAGAATGGAATTCCCACAGAGTATGGGGTGCCACACAC
TCAAGACTATGCCGGCCAGACCGGTGAGCATAACCTGACACTCTACGGAAGTACGCAAGCCCACGGGGAG
CAGAGCAGCAACTCACCCAGCACACAAAATGGATCTCTTACGACAGAAGGTGGAGCACAGACAGACGGCC
AGCAGTCACAGACACAAAGTAGTGAAAATTCAGAGAGTAAATCTACCCCGAAACGGCTGCATGTCTCTAA
TATTCCTTTCCGCTTCCGGGACCCTGACCTCCGGCAGATGTTTGGGCAGTTTGGCAAAATCCTAGATGTA
GAAATAATCTTTAATGAACGTGGCTCTAAGGGATTCGGGTTCGTAACTTTCGAGAATAGTGCTGATGCAG
ACAGGGCCAGGGAGAAATTACACGGCACCGTGGTAGAGGGCCGTAAAATCGAGGTGAATAATGCTACAGC
ACGTGTAATGACCAATAAGAAGATGGTCACACCATATGCAAATGGTTGGAAATTAAGCCCAGTAGTTGGA
GCTGTATATGGTCCGGAGTTATATGCAGCATCCAGCTTTCAAGCAGATGTGTCCCTAGGCAATGATGCAG
CAGTGCCCCTATCAGGAAGAGGGGGTATCAACACTTACATTCCTTTAATCATTCCTGGCTTCCCTTACCC
TACTGCAGCCACCACGGCAGCCGCTTTCAGAGGAGCCCATTTGAGGGGCAGAGGGCGGACAGTATATGGT
GCAGTCCGAGCGGTACCTCCAACAGCCATCCCCGCCTATCCAGGTGTGGTTTACCAGGACGGATTTTACG
GTGCTGACCTCTATGGTGGATATGCAGCCTACAGATATGCACAGCCTGCTACTGCAACCGCAGCCACCGC
TGCTGCAGCCGCTGCAGCCGCTTACAGTGACGGTTATGGCAGGGTGTACACAGCCGACCCCTACCATGCC
CTTGCCCCTGCCGCTAGCTATGGAGTTGGCGCTGTGGCGAGTTTATACCGAGGTGGCTACAGCCGATTTG
CCCCCTACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001082576
ORF Size 1131 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001082576.1, NP_001076045.1
RefSeq Size 6985
RefSeq ORF 1131
Locus ID 23543
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene is one of several human genes similar to the C. elegans gene Fox-1. This gene encodes an RNA binding protein that is thought to be a key regulator of alternative exon splicing in the nervous system and other cell types. The protein binds to a conserved UGCAUG element found downstream of many alternatively spliced exons and promotes inclusion of the alternative exon in mature transcripts. The protein also interacts with the estrogen receptor 1 transcription factor and regulates estrogen receptor 1 transcriptional activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The resulting protein (isoform 3) is 4-aa shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.