RBFOX2 (NM_001082578) Human Untagged Clone
CAT#: SC316000
RBFOX2 (untagged)-Human RNA binding protein, fox-1 homolog (C. elegans) 2 (RBFOX2), transcript variant 5
"NM_001082578" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RBFOX2 |
Synonyms | dJ106I20.3; Fox-2; FOX2; fxh; HNRBP2; HRNBP2; RBM9; RTA |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001082578, the custom clone sequence may differ by one or more nucleotides
ATGGCGGAGGGCGCCCAGCCGCAGCAGCCGCCTCAGCTCGGGCCCGGCGCCGCCGCCCGGGGCATGAAGC GGGAGTCGGAGCTGGAGCTGCCGGTGCCCGGAGCGGGAGGAGACGGAGCCGATCCCGGCCTGAGCAAGCG GCCGCGCACTGAGGAGGCGGCGGCCGACGGTGGCGGCGGGATGCAGAACGAGCCTCTGACTCCAGGTTAT CATGGATTCCCAGCGCGGGACAGCCAGGGTAACCAGGAGCCGACAACAACTCCTGACGCAATGGTTCAGC CTTTTACTACCATCCCATTTCCACCACCTCCGCAGAATGGAATTCCCACAGAGTATGGGGTGCCACACAC TCAAGACTATGCCGGCCAGACCGGTGAGCATAACCTGACACTCTACGGAAGTACGCAAGCCCACGGGGAG CAGAGCAGCAACTCACCCAGCACACAAAATGGATCTCTTACGCAGACAGAAGGTGGAGCACAGACAGACG GCCAGCAGTCACAGACACAAAGTAGTGAAAATTCAGAGAGTAAATCTACCCCGAAACGGCTGCATGTCTC TAATATTCCTTTCCGCTTCCGGGACCCTGACCTCCGGCAGATGTTTGGGCAGTTTGGCAAAATCCTAGAT GTAGAAATAATCTTTAATGAACGTGGCTCTAAGGGATTCGGGTTCGTAACTTTCGAGAATAGTGCTGATG CAGACAGGGCCAGGGAGAAATTACACGGCACCGTGGTAGAGGGCCGTAAAATCGAGGTGAATAATGCTAC AGCACGTGTAATGACCAATAAGAAGATGGTCACACCATATGCAAATGGTTGGAAATTAAGCCCAGTAGTT GGAGCTGTATATGGTCCGGAGTTATATGCAGCATCCAGCTTTCAAGCAGATGTGTCCCTAGGCAATGATG CAGCAGTGCCCCTATCAGGAAGAGGGGGTATCAACACTTACATTCCTTTAATCAGTCTCCCTTTAGTTCC TGGCTTCCCTTACCCTACTGCAGCCACCACGGCAGCCGCTTTCAGAGGAGCCCATTTGAGGGGCAGAGGG CGGACAGTATATGGTGCAGTCCGAGCGGTACCTCCAACAGCCATCCCCGCCTATCCAGGTGTGGTTTACC AGGACGGATTTTACGGTGCTGACCTCTATGGTGGATATGCAGCCTACAGATATGCACAGCCTGCTACTGC AACCGCAGCCACCGCTGCTGCAGCCGCTGCAGCCGCTTACAGTGACGGTTATGGCAGGGTGTACACAGCC GACCCCTACCATGCCCTTGCCCCTGCCGCTAGCTATGGAGTTGGCGCTGTGGCGAGTTTATACCGAGGTG GCTACAGCCGATTTGCCCCCTACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001082578 |
ORF Size | 1356 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001082578.1, NP_001076047.1 |
RefSeq Size | 6957 |
RefSeq ORF | 1356 |
Locus ID | 23543 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene is one of several human genes similar to the C. elegans gene Fox-1. This gene encodes an RNA binding protein that is thought to be a key regulator of alternative exon splicing in the nervous system and other cell types. The protein binds to a conserved UGCAUG element found downstream of many alternatively spliced exons and promotes inclusion of the alternative exon in mature transcripts. The protein also interacts with the estrogen receptor 1 transcription factor and regulates estrogen receptor 1 transcriptional activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (5) contains a distinct 5' UTR, 5' CDS, and uses an alternate in-frame splice site in the coding region, compared to variant 1. The resulting protein (isoform 5) is longer and has a distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. CCDS Note: This CCDS representation is supported by accession DQ778625.1. It includes an alternative splice acceptor for exon 10 compared to the variants represented by NM_014309.2 (CCDS13921.1) and NM_001082576.1 (CCDS46701.1). This is a non-canonical 'GG' splice acceptor site as compared to the 'AG' acceptor found in NM_014309.2 and NM_001082576.1, but the 'GG' splice acceptor is supported by 30 human transcripts and by transcripts in other species, including mouse (e.g., AK139555.1, AK077594.1, AK055213.1, AY659953.1, DQ017388.1 and several ESTs), rat (BC128766.1, BM388666.1), cow (BT026301.1 and several ESTs), pig (AK236515.1 and a few ESTs), sheep (EE755507.1, EE862219.1) and dog (CO666028.1, CO586266.1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217209 | RBFOX2 (Myc-DDK-tagged)-Human RNA binding protein, fox-1 homolog (C. elegans) 2 (RBFOX2), transcript variant 5 |
USD 420.00 |
|
RG217209 | RBFOX2 (GFP-tagged) - Human RNA binding protein, fox-1 homolog (C. elegans) 2 (RBFOX2), transcript variant 5 |
USD 460.00 |
|
RC217209L3 | Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 2 (RBFOX2), transcript variant 5, Myc-DDK-tagged |
USD 620.00 |
|
RC217209L4 | Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 2 (RBFOX2), transcript variant 5, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review