UQCRHL (NM_001089591) Human Untagged Clone
CAT#: SC316097
UQCRHL (untagged)-Human ubiquinol-cytochrome c reductase hinge protein-like (UQCRHL)
"NM_001089591" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | UQCRHL |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001089591, the custom clone sequence may differ by one or more nucleotides
ATGGGACTGGAGGACGAGCAAAAGATGCTTACCGAATCCGGAGATCCTGAGGAGGAGGAAGAGGAAGAGG AGGAATTAGTGGATCCCCTAACAACAGTGAGAGAGCAATGCGAGCAGTTGGAGAAATGTGTAAAGGCCCG GGAGCGGCTAGAGCTCTATGATGAGCATGTATCCTCTCGATCACATACAGAAGAGGATTGCACGGAGGAG CTCTTTGACTTCTTGCATGCAAAGGACCATTGCGTGGCCCACAAACTCTTTAACAACTTGAAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001089591 |
ORF Size | 276 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001089591.1, NP_001083060.1 |
RefSeq Size | 538 |
RefSeq ORF | 276 |
Locus ID | 440567 |
Protein Pathways | Alzheimer's disease, Cardiac muscle contraction, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Gene Summary | This gene has characteristics of a pseudogene derived from the UQCRH gene. However, there is still an open reading frame that could produce a protein of the same or nearly the same size as that of the UQCRH gene, so this gene is being called protein-coding for now. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219881 | UQCRHL (Myc-DDK-tagged)-Human ubiquinol-cytochrome c reductase hinge protein-like (UQCRHL) |
USD 420.00 |
|
RG219881 | UQCRHL (GFP-tagged) - Human ubiquinol-cytochrome c reductase hinge protein-like (UQCRHL) |
USD 460.00 |
|
RC219881L3 | Lenti ORF clone of Human ubiquinol-cytochrome c reductase hinge protein-like (UQCRHL), Myc-DDK-tagged |
USD 620.00 |
|
RC219881L4 | Lenti ORF clone of Human ubiquinol-cytochrome c reductase hinge protein-like (UQCRHL), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review