C11orf83 (UQCC3) (NM_001085372) Human Untagged Clone

CAT#: SC316098

C11orf83 (untagged)-Human chromosome 11 open reading frame 83 (C11orf83)


  "NM_001085372" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "UQCC3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UQCC3
Synonyms C11orf83; CCDS41658.1; MC3DN9; UNQ655
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001085372 edited
GCAACAGCTTGCGGCTGCGGGGAGCTCCCGTGGGCGCTCCGCTGGCTGTGCAGGCGGCCA
TGGATTCCTTGCGGAAAATGCTGATCTCAGTCGCAATGCTGGGCGCAGGGGCTGGCGTGG
GCTACGCGCTCCTCGTTATCGTGACCCCGGGAGAGCGGCGGAAGCAGGAAATGCTAAAGG
AGATGCCACTGCAGGACCCAAGGAGCAGGGAGGAGGCGGCCAGGACCCAGCAGCTATTGC
TGGCCACTCTGCAGGAGGCAGCGACCACGCAGGAGAACGTGGCCTGGAGGAAGAACTGGA
TGGTTGGCGGCGAAGGCGGCGCCAGCGGGAGGTCACCGTGAGACCGGACTTGCCTCCGTG
GGCGCCGGACCTTGGCTTGGGCGCAGGAATCCGAGGCAGCCTTTCTCCTTCGTGGGCCCA
GCGGAGAGTCCGGACCGAGATACCATGCCAGGACTCTCCGGGGTCCTGTGAGCTGCCGTC
GGGTGAGCACGTTTCCCCCAAACCCTGGACTGACTGCTTTAAGGTCCGCAAGGCGGGCCA
GGGCCGAGACGCGAGTCGGATGTGGTGAACTGAAAGAACCAATAAAATCATGTTCCTCCA
CCCAGAATGAGCCCTGCAGTC
Restriction Sites Please inquire     
ACCN NM_001085372
ORF Size 282 bp
Insert Size 700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001085372.1, NP_001078841.1
RefSeq Size 658
RefSeq ORF 282
Locus ID 790955
Protein Families Transmembrane
Gene Summary Complex III is a mitochondrial inner membrane protein complex that transfers electrons from ubiquinol to cytochrome c. This gene encodes a protein that functions in complex III assembly. Mutations in this gene result in Mitochondrial complex III deficiency, nuclear type 9. [provided by RefSeq, Dec 2014]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.