POLR2J2 (POLR2J3) (NM_001097615) Human Untagged Clone

CAT#: SC316107

POLR2J3 (untagged)-Human polymerase (RNA) II (DNA directed) polypeptide J3 (POLR2J3)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: POLR2J3
• Synonyms: POLR2J2; RPB11b1; RPB11b2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001097615, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACGCCCCTCCAGCCTTCGAGTCGTTCTTGCTCTTCGAGGGCGAGAAGATCACCATTAACAAGGACA
  CCAAGGTACCCAATGCCTGTTTATTCACCATCAACAAAGAAGACCACACACTGGGAAACATCATTAAATC
  ACAACTCCTAAAAGACCCGCAAGTGCTATTTGCTGGCTACAAAGTCCCCCACCCCTTGGAGCACAAGATC
  ATCATCCGAGTGCAGACCACGCCGGACTACAGCCCCCAGGAAGCCTTTACCAACGCCATCACCGACCTCA
  TCAGTGAGCTGTCCCTGCTGGAGGAGCGCTTCCGGACGTGCCTGCTTCCCCTTCGCCTTCTGCCGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001097615
• ORF Size: 348 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001097615.2, NP_001091084.2
• RefSeq Size: 1680
• RefSeq ORF: 348
• Locus ID: 548644
• Protein Pathways: Huntington's disease, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
• Gene Summary: This gene is a member of the RNA polymerase II subunit 11 gene family, which includes three genes in a cluster on chromosome 7q22.1 and a pseudogene on chromosome 7p13. The founding member of this family, DNA directed RNA polymerase II polypeptide J, has been shown to encode a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This locus produces multiple, alternatively spliced transcripts that potentially express isoforms with distinct C-termini compared to DNA directed RNA polymerase II polypeptide J. Most or all variants are spliced to include additional non-coding exons at the 3' end which makes them candidates for nonsense-mediated decay (NMD). Consequently, it is not known if this locus expresses a protein or proteins in vivo. [provided by RefSeq, Jul 2008]