PAIP2B (NM_020459) Human Untagged Clone

CAT#: SC316122

PAIP2B (untagged)-Human poly(A) binding protein interacting protein 2B (PAIP2B)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PAIP2B
• Synonyms: KIAA1155
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_020459, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAATGGATCCAATATGGCAAATACATCACCGAGTGTAAAATCCAAAGAGGACCAGGGGTTAAGTGGGC
  ACGATGAAAAGGAAAACCCATTTGCAGAGTACATGTGGATGGAGAATGAAGAGGATTTCAACAGACAGGT
  GGAGGAGGAACTGCAGGAGCAAGACTTCTTGGACCGCTGCTTCCAAGAGATGCTGGATGAAGAAGACCAA
  GACTGGTTTATTCCCTCACGAGACCTGCCTCAGGCCATGGGACAGTTGCAACAGCAGTTAAATGGACTGT
  CAGTCAGTGAAGGTCATGATTCTGAAGATATTTTGAGCAAAAGTAACCTGAACCCAGATGCCAAGGAGTT
  TATTCCAGGAGAGAAGTACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_020459
• ORF Size: 372 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_020459.1, NP_065192.1
• RefSeq Size: 6300
• RefSeq ORF: 372
• Locus ID: 400961
• Gene Summary: Most mRNAs, except for histones, contain a 3-prime poly(A) tail. Poly(A)-binding protein (PABP; see MIM 604679) enhances translation by circularizing mRNA through its interaction with the translation initiation factor EIF4G1 (MIM 600495) and the poly(A) tail. Various PABP-binding proteins regulate PABP activity, including PAIP1 (MIM 605184), a translational stimulator, and PAIP2A (MIM 605604) and PAIP2B, translational inhibitors (Derry et al., 2006 [PubMed 17381337]). [supplied by OMIM, Mar 2008]