XAGE1A (NM_001097592) Human Untagged Clone

CAT#: SC316132

XAGE1A (untagged)-Human X antigen family, member 1A (XAGE1A), transcript variant a

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: XAGE1A
• Synonyms: CT12.1; CT12.1A; CTP9; GAGED2; XAGE1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001097592, the custom clone sequence may differ by one or more nucleotides
  ATGCTCCTTTGGTGCCCACCTCAGTGCGCATGTTCACTGGGCGTCTTCCCATCGGCCCCT
  TCGCCAGTGTGGGGAACGCGGCGGAGCTGTGAGCCGGCGACTCGGGTCCCTGAGGTCTGG
  ATTCTTTCTCCGCTACTGAGACACGGCGGACACACACAAACACAGAACCACACAGCCAGT
  CCCAGGAGCCCAGTAATGGAGAGCCCCAAAAAGAAGAACCAGCAGCTGAAAGTCGGGATC
  CTACACCTGGGCAGCAGACAGAAGAAGATCAGGATACAGCTGAGATCCCAGTGCGCGACA
  TGGAAGGTGATCTGCAAGAGCTGCATCAGTCAAACACCGGGGATAAATCTGGATTTGGGT
  TCCGGCGTCAAGGTGAAGATAATACCTAAAGAGGAACACTGTAAAATGCCAGAAGCAGGT
  GAAGAGCAACCACAAGTT
  
• Restriction Sites: Please inquire
• ACCN: NM_001097592
• ORF Size: 441 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001097592.1, NP_001091061.1
• RefSeq Size: 614
• RefSeq ORF: 441
• Locus ID: 653219
• Gene Summary: This gene is a member of the XAGE subfamily, which belongs to the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is strongly expressed in Ewing's sarcoma, alveolar rhabdomyosarcoma and normal testis. The protein encoded by this gene contains a nuclear localization signal and shares a sequence similarity with other GAGE/PAGE proteins. Because of the expression pattern and the sequence similarity, this protein also belongs to a family of CT (cancer-testis) antigens. Alternative splicing of this gene, in addition to alternative transcription start sites, results in multiple transcript variants. [provided by RefSeq, Jan 2010]
  Transcript Variant: This variant (a, also known as XAGE-1a) encodes the longer isoform (a, also known as isoform XAGE-1b). This variant also includes a major downstream transcription start site, which results in the variant referred to as XAGE-1b in the literature. Both XAGE-1a and XAGE-1b encode the same isoform.