MRAS (NM_001085049) Human Untagged Clone

CAT#: SC316159

MRAS (untagged)-Human muscle RAS oncogene homolog (MRAS), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MRAS
• Synonyms: M-RAs; R-RAS3; RRAS3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001085049, the custom clone sequence may differ by one or more nucleotides
  ATGGCAACCAGCGCCGTCCCCAGTGACAACCTCCCCACATACAAGCTGGTGGTGGTGGGG
  GATGGGGGTGTGGGCAAAAGTGCCCTCACCATCCAGTTTTTCCAGAAGATCTTTGTGCCT
  GACTATGACCCCACCATTGAAGACTCCTACCTGAAACATACGGAGATTGACAATCAATGG
  GCCATCTTGGACGTTCTGGACACAGCTGGGCAGGAGGAATTCAGCGCCATGCGGGAGCAA
  TACATGCGCACGGGGGATGGCTTCCTCATCGTCTACTCCGTCACTGACAAGGCCAGCTTT
  GAGCACGTGGACCGCTTCCACCAGCTTATCCTGCGCGTCAAAGACAGGGAGTCATTCCCG
  ATGATCCTCGTGGCCAACAAGGTCGATTTGATGCACTTGAGGAAGATCACCAGGGAGCAA
  GGAAAAGAAATGGCGACCAAACACAATATTCCGTACATAGAAACCAGTGCCAAGGACCCA
  CCTCTCAATGTCGACAAAGCCTTCCATGACCTCGTTAGAGTAATTAGGCAACAGATTCCG
  GAAAAAAGCCAGAAGAAGAAGAAGAAAACCAAATGGCGGGGAGACCGGGCCACAGGCACC
  CACAAACTGCAATGTGTGATCTTG
  
• Restriction Sites: Please inquire
• ACCN: NM_001085049
• ORF Size: 627 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001085049.1, NP_001078518.1
• RefSeq Size: 4013
• RefSeq ORF: 627
• Locus ID: 22808
• Protein Families: Druggable Genome
• Protein Pathways: MAPK signaling pathway, Regulation of actin cytoskeleton, Tight junction
• Gene Summary: This gene encodes a member of the Ras family of small GTPases. These membrane-associated proteins function as signal transducers in multiple processes including cell growth and differentiation, and dysregulation of Ras signaling has been associated with many types of cancer. The encoded protein may play a role in the tumor necrosis factor-alpha and MAP kinase signaling pathways. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same isoform (1).