CD272 (BTLA) (NM_001085357) Human Untagged Clone

CAT#: SC316167

BTLA (untagged)-Human B and T lymphocyte associated (BTLA), transcript variant 2


  "NM_001085357" in other vectors (6)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "BTLA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BTLA
Synonyms BTLA1; CD272
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001085357, the custom clone sequence may differ by one or more nucleotides


ATGAAGACATTGCCTGCCATGCTTGGAACTGGGAAATTATTTTGGGTCTTCTTCTTAATCCCATATCTGG
ACATCTGGAACATCCATGGGAAAGAATCATGTGATGTACAGCTTTATATAAAGAGACAATCTGAACACTC
CATCTTAGCAGGAGATCCCTTTGAACTAGAATGCCCTGTGAAATACTGTGCTAACAGGCCTCATGTGACT
TGGTGCAAGCTCAATGGAACAACATGTGTAAAACTTGAAGATAGACAAACAAGTTGGAAGGAAGAGAAGA
ACATTTCATTTTTCATTCTACATTTTGAACCAGTGCTTCCTAATGACAATGGGTCATACCGCTGTTCTGC
AAATTTTCAGTCTAATCTCATTGAAAGCCACTCAACAACTCTTTATGTGACAGGAAAGCAAAATGAACTC
TCTGACACAGCAGGAAGGGAAATTAACCTGGTTGATGCTCACCTTAAGAGTGAGCAAACAGAAGCAAGCA
CCAGGCAAAATTCCCAAGTACTGCTATCAGAAACTGGAATTTATGATAATGACCCTGACCTTTGTTTCAG
GATGCAGGAAGGGTCTGAAGTTTATTCTAATCCATGCCTGGAAGAAAACAAACCAGGCATTGTTTATGCT
TCCCTGAACCATTCTGTCATTGGACCGAACTCAAGACTGGCAAGAAATGTAAAAGAAGCACCAACAGAAT
ATGCATCCATATGTGTGAGGAGTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001085357
ORF Size 726 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001085357.1, NP_001078826.1
RefSeq Size 3072
RefSeq ORF 726
Locus ID 151888
Protein Families Transmembrane
Gene Summary This gene encodes a member of the immunoglobulin superfamily. The encoded protein contains a single immunoglobulin (Ig) domain and is a receptor that relays inhibitory signals to suppress the immune response. Alternative splicing results in multiple transcript variants. Polymorphisms in this gene have been associated with an increased risk of rheumatoid arthritis. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.