GJB1 (NM_001097642) Human Untagged Clone

CAT#: SC316177

GJB1 (untagged)-Human gap junction protein, beta 1, 32kDa (GJB1), transcript variant 1


  "NM_001097642" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GJB1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GJB1
Synonyms CMTX; CMTX1; CX32
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001097642, the custom clone sequence may differ by one or more nucleotides


ATGAACTGGACAGGTTTGTACACCTTGCTCAGTGGCGTGAACCGGCATTCTACTGCCATTGGCCGAGTAT
GGCTCTCGGTCATCTTCATCTTCAGAATCATGGTGCTGGTGGTGGCTGCAGAGAGTGTGTGGGGTGATGA
GAAATCTTCCTTCATCTGCAACACACTCCAGCCTGGCTGCAACAGCGTTTGCTATGACCAATTCTTCCCC
ATCTCCCATGTGCGGCTGTGGTCCCTGCAGCTCATCCTAGTTTCCACCCCAGCTCTCCTCGTGGCCATGC
ACGTGGCTCACCAGCAACACATAGAGAAGAAAATGCTACGGCTTGAGGGCCATGGGGACCCCCTACACCT
GGAGGAGGTGAAGAGGCACAAGGTCCACATCTCAGGGACACTGTGGTGGACCTATGTCATCAGCGTGGTG
TTCCGGCTGTTGTTTGAGGCCGTCTTCATGTATGTCTTTTATCTGCTCTACCCTGGCTATGCCATGGTGC
GGCTGGTCAAGTGCGACGTCTACCCCTGCCCCAACACAGTGGACTGCTTCGTGTCCCGCCCCACCGAGAA
AACCGTCTTCACCGTCTTCATGCTAGCTGCCTCTGGCATCTGCATCATCCTCAATGTGGCCGAGGTGGTG
TACCTCATCATCCGGGCCTGTGCCCGCCGAGCCCAGCGCCGCTCCAATCCACCTTCCCGCAAGGGCTCGG
GCTTCGGCCACCGCCTCTCACCTGAATACAAGCAGAATGAGATCAACAAGCTGCTGAGTGAGCAGGATGG
CTCCCTGAAAGACATACTGCGCCGCAGCCCTGGCACCGGGGCTGGGCTGGCTGAAAAGAGCGACCGCTGC
TCGGCCTGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001097642
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001097642.2, NP_001091111.1
RefSeq Size 1623 bp
RefSeq ORF 852 bp
Locus ID 2705
Cytogenetics Xq13.1
Protein Families Druggable Genome, Ion Channels: Other, Transmembrane
Gene Summary 'This gene encodes a member of the gap junction protein family. The gap junction proteins are membrane-spanning proteins that assemble to form gap junction channels that facilitate the transfer of ions and small molecules between cells. According to sequence similarities at the nucleotide and amino acid levels, the gap junction proteins are divided into two categories, alpha and beta. Mutations in this gene cause X-linked Charcot-Marie-Tooth disease, an inherited peripheral neuropathy. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2008]'
Transcript Variant: This variant (1) represents the shorter transcript, and is transcribed from promoter P1. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.