GJB1 (NM_001097642) Human Untagged Clone
CAT#: SC316177
GJB1 (untagged)-Human gap junction protein, beta 1, 32kDa (GJB1), transcript variant 1
"NM_001097642" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GJB1 |
Synonyms | CMTX; CMTX1; CX32 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001097642, the custom clone sequence may differ by one or more nucleotides
ATGAACTGGACAGGTTTGTACACCTTGCTCAGTGGCGTGAACCGGCATTCTACTGCCATTGGCCGAGTAT GGCTCTCGGTCATCTTCATCTTCAGAATCATGGTGCTGGTGGTGGCTGCAGAGAGTGTGTGGGGTGATGA GAAATCTTCCTTCATCTGCAACACACTCCAGCCTGGCTGCAACAGCGTTTGCTATGACCAATTCTTCCCC ATCTCCCATGTGCGGCTGTGGTCCCTGCAGCTCATCCTAGTTTCCACCCCAGCTCTCCTCGTGGCCATGC ACGTGGCTCACCAGCAACACATAGAGAAGAAAATGCTACGGCTTGAGGGCCATGGGGACCCCCTACACCT GGAGGAGGTGAAGAGGCACAAGGTCCACATCTCAGGGACACTGTGGTGGACCTATGTCATCAGCGTGGTG TTCCGGCTGTTGTTTGAGGCCGTCTTCATGTATGTCTTTTATCTGCTCTACCCTGGCTATGCCATGGTGC GGCTGGTCAAGTGCGACGTCTACCCCTGCCCCAACACAGTGGACTGCTTCGTGTCCCGCCCCACCGAGAA AACCGTCTTCACCGTCTTCATGCTAGCTGCCTCTGGCATCTGCATCATCCTCAATGTGGCCGAGGTGGTG TACCTCATCATCCGGGCCTGTGCCCGCCGAGCCCAGCGCCGCTCCAATCCACCTTCCCGCAAGGGCTCGG GCTTCGGCCACCGCCTCTCACCTGAATACAAGCAGAATGAGATCAACAAGCTGCTGAGTGAGCAGGATGG CTCCCTGAAAGACATACTGCGCCGCAGCCCTGGCACCGGGGCTGGGCTGGCTGAAAAGAGCGACCGCTGC TCGGCCTGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001097642 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001097642.2, NP_001091111.1 |
RefSeq Size | 1623 bp |
RefSeq ORF | 852 bp |
Locus ID | 2705 |
Cytogenetics | Xq13.1 |
Protein Families | Druggable Genome, Ion Channels: Other, Transmembrane |
Gene Summary | 'This gene encodes a member of the gap junction protein family. The gap junction proteins are membrane-spanning proteins that assemble to form gap junction channels that facilitate the transfer of ions and small molecules between cells. According to sequence similarities at the nucleotide and amino acid levels, the gap junction proteins are divided into two categories, alpha and beta. Mutations in this gene cause X-linked Charcot-Marie-Tooth disease, an inherited peripheral neuropathy. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2008]' Transcript Variant: This variant (1) represents the shorter transcript, and is transcribed from promoter P1. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211786 | GJB1 (Myc-DDK-tagged)-Human gap junction protein, beta 1, 32kDa (GJB1), transcript variant 1 |
USD 420.00 |
|
RG211786 | GJB1 (GFP-tagged) - Human gap junction protein, beta 1, 32kDa (GJB1), transcript variant 1 |
USD 460.00 |
|
RC211786L3 | Lenti ORF clone of Human gap junction protein, beta 1, 32kDa (GJB1), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC211786L4 | Lenti ORF clone of Human gap junction protein, beta 1, 32kDa (GJB1), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review