G protein coupled receptor 30 (GPER1) (NM_001098201) Human Untagged Clone
CAT#: SC316195
GPER (untagged)-Human G protein-coupled estrogen receptor 1 (GPER), transcript variant 4
"NM_001098201" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GPER1 |
Synonyms | CEPR; CMKRL2; DRY12; FEG-1; GPCR-Br; GPER; GPR30; LERGU; LERGU2; LyGPR; mER |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001098201, the custom clone sequence may differ by one or more nucleotides
ATGGATGTGACTTCCCAAGCCCGGGGCGTGGGCCTGGAGATGTACCCAGGCACCGCGCAGCCTGCGGCCC CCAACACCACCTCCCCCGAGCTCAACCTGTCCCACCCGCTCCTGGGCACCGCCCTGGCCAATGGGACAGG TGAGCTCTCGGAGCACCAGCAGTACGTGATCGGCCTGTTCCTCTCGTGCCTCTACACCATCTTCCTCTTC CCCATCGGCTTTGTGGGCAACATCCTGATCCTGGTGGTGAACATCAGCTTCCGCGAGAAGATGACCATCC CCGACCTGTACTTCATCAACCTGGCGGTGGCGGACCTCATCCTGGTGGCCGACTCCCTCATTGAGGTGTT CAACCTGCACGAGCGGTACTACGACATCGCCGTCCTGTGCACCTTCATGTCGCTCTTCCTGCAGGTCAAC ATGTACAGCAGCGTCTTCTTCCTCACCTGGATGAGCTTCGACCGCTACATCGCCCTGGCCAGGGCCATGC GCTGCAGCCTGTTCCGCACCAAGCACCACGCCCGGCTGAGCTGTGGCCTCATCTGGATGGCATCCGTGTC AGCCACGCTGGTGCCCTTCACCGCCGTGCACCTGCAGCACACCGACGAGGCCTGCTTCTGTTTCGCGGAT GTCCGGGAGGTGCAGTGGCTCGAGGTCACGCTGGGCTTCATCGTGCCCTTCGCCATCATCGGCCTGTGCT ACTCCCTCATTGTCCGGGTGCTGGTCAGGGCGCACCGGCACCGTGGGCTGCGGCCCCGGCGGCAGAAGGC GCTCCGCATGATCCTCGCGGTGGTGCTGGTCTTCTTCGTCTGCTGGCTGCCGGAGAACGTCTTCATCAGC GTGCACCTCCTGCAGCGGACGCAGCCTGGGGCCGCTCCCTGCAAGCAGTCTTTCCGCCATGCCCACCCCC TCACGGGCCACATTGTCAACCTCGCCGCCTTCTCCAACAGCTGCCTAAACCCCCTCATCTACAGCTTTCT CGGGGAGACCTTCAGGGACAAGCTGAGGCTGTACATTGAGCAGAAAACAAATTTGCCGGCCCTGAACCGC TTCTGTCACGCTGCCCTGAAGGCCGTCATTCCAGACAGCACCGAGCAGTCGGATGTGAGGTTCAGCAGTG CCGTGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001098201 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001098201.1, NP_001091671.1 |
RefSeq Size | 2654 bp |
RefSeq ORF | 1128 bp |
Locus ID | 2852 |
Cytogenetics | 7p22.3 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Gene Summary | 'This gene encodes a multi-pass membrane protein that localizes to the endoplasmic reticulum and a member of the G-protein coupled receptor 1 family. This receptor binds estrogen and activates multiple downstream signaling pathways, leading to stimulation of adenylate cyclase and an increase in cyclic AMP levels, while also promoting intracellular calcium mobilization and synthesis of phosphatidylinositol 3,4,5-trisphosphate in the nucleus. This protein therefore plays a role in the rapid nongenomic signaling events widely observed following stimulation of cells and tissues with estrogen. This receptor has been shown to play a role in diverse biological processes, including bone and nervous system development, metabolism, cognition, male fertility and uterine function. [provided by RefSeq, Aug 2017]' Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 3. Variants 2-4 encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212278 | GPER (Myc-DDK-tagged)-Human G protein-coupled estrogen receptor 1 (GPER), transcript variant 4 |
USD 420.00 |
|
RG212278 | GPER (GFP-tagged) - Human G protein-coupled estrogen receptor 1 (GPER), transcript variant 4 |
USD 460.00 |
|
RC212278L3 | Lenti ORF clone of Human G protein-coupled estrogen receptor 1 (GPER), transcript variant 4, Myc-DDK-tagged |
USD 768.00 |
|
RC212278L4 | Lenti ORF clone of Human G protein-coupled estrogen receptor 1 (GPER), transcript variant 4, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review