RPP14 (NM_001098783) Human Untagged Clone

CAT#: SC316328

RPP14 (untagged)-Human ribonuclease P/MRP 14kDa subunit (RPP14), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RPP14
• Synonyms: P14
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001098783, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCTGCCCCTGCTGCCACATATGAAAGAGTAGTTTACAAAAACCCTTCCGAGTACCACTACATGAAAG
  TCTGCCTAGAATTTCAAGATTGTGGAGTTGGACTGAATGCTGCACAGTTCAAACAGCTGCTTATTTCGGC
  TGTGAAGGACCTGTTTGGGGAGGTTGATGCCGCCTTACCTTTGGACATCCTAACCTATGAAGAGAAGACC
  TTGTCAGCCATCTTGAGAATATGTAGCAGTGGTCTTGTCAAATTGTGGAGCTCTTTGACCCTGTTAGGAT
  CCTATAAAGGCAAAAAATGTGCTTTCCGGGTGATTCAGGTTTCTCCATTTCTTCTTGCATTATCTGGTAA
  TAGTAGGGAACTAGTATTGGATTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001098783
• ORF Size: 375 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001098783.2, NP_001092253.1
• RefSeq Size: 3500
• RefSeq ORF: 375
• Locus ID: 11102
• Gene Summary: This gene encodes a subunit of ribonuclease P and has 3' to 5' exoribonuclease activity. Transcripts for this gene are bicistronic and include a conserved downstream open reading frame for the hydroxyacyl-thioester dehydratase type 2 (HTD2) gene. [provided by RefSeq, May 2017]
  Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.