RPP14 (NM_001098783) Human Untagged Clone

CAT#: SC316328

RPP14 (untagged)-Human ribonuclease P/MRP 14kDa subunit (RPP14), transcript variant 1


  "NM_001098783" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RPP14"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RPP14
Synonyms P14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001098783, the custom clone sequence may differ by one or more nucleotides


ATGCCTGCCCCTGCTGCCACATATGAAAGAGTAGTTTACAAAAACCCTTCCGAGTACCACTACATGAAAG
TCTGCCTAGAATTTCAAGATTGTGGAGTTGGACTGAATGCTGCACAGTTCAAACAGCTGCTTATTTCGGC
TGTGAAGGACCTGTTTGGGGAGGTTGATGCCGCCTTACCTTTGGACATCCTAACCTATGAAGAGAAGACC
TTGTCAGCCATCTTGAGAATATGTAGCAGTGGTCTTGTCAAATTGTGGAGCTCTTTGACCCTGTTAGGAT
CCTATAAAGGCAAAAAATGTGCTTTCCGGGTGATTCAGGTTTCTCCATTTCTTCTTGCATTATCTGGTAA
TAGTAGGGAACTAGTATTGGATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001098783
ORF Size 375 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001098783.2, NP_001092253.1
RefSeq Size 3500
RefSeq ORF 375
Locus ID 11102
Gene Summary This gene encodes a subunit of ribonuclease P and has 3' to 5' exoribonuclease activity. Transcripts for this gene are bicistronic and include a conserved downstream open reading frame for the hydroxyacyl-thioester dehydratase type 2 (HTD2) gene. [provided by RefSeq, May 2017]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.