HLAF (HLA-F) (NM_001098479) Human Untagged Clone

CAT#: SC316374

HLA (untagged)-Human major histocompatibility complex, class I, F (HLA-F), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HLA-F
• Synonyms: CDA12; HLA-5.4; HLA-CDA12; HLAF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001098479, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGCCCCGAAGCCTCCTCCTGCTGCTCTCAGGGGCCCTGGCCCTGACCGATACTTGGGCGGGCTCCC
  ACTCCTTGAGGTATTTCAGCACCGCTGTGTCGCGGCCCGGCCGCGGGGAGCCCCGCTACATCGCCGTGGA
  GTACGTAGACGACACGCAATTCCTGCGGTTCGACAGCGACGCCGCGATTCCGAGGATGGAGCCGCGGGAG
  CCGTGGGTGGAGCAAGAGGGGCCGCAGTATTGGGAGTGGACCACAGGGTACGCCAAGGCCAACGCACAGA
  CTGACCGAGTGGCCCTGAGGAACCTGCTCCGCCGCTACAACCAGAGCGAGGCTGGGTCTCACACCCTCCA
  GGGAATGAATGGCTGCGACATGGGGCCCGACGGACGCCTCCTCCGCGGGTATCACCAGCACGCGTACGAC
  GGCAAGGATTACATCTCCCTGAACGAGGACCTGCGCTCCTGGACCGCGGCGGACACCGTGGCTCAGATCA
  CCCAGCGCTTCTATGAGGCAGAGGAATATGCAGAGGAGTTCAGGACCTACCTGGAGGGCGAGTGCCTGGA
  GTTGCTCCGCAGATACTTGGAGAATGGGAAGGAGACGCTACAGCGCGCAGATCCTCCAAAGGCACACGTT
  GCCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGA
  TCACGCTGACCTGGCAGCGGGATGGGGAGGAACAGACCCAGGACACAGAGCTTGTGGAGACCAGGCCTGC
  AGGGGATGGAACCTTCCAGAAGTGGGCCGCTGTGGTGGTGCCTCCTGGAGAGGAACAGAGATACACATGC
  CATGTGCAGCACGAGGGGCTGCCCCAGCCCCTCATCCTGAGATGGGAGCAGTCTCCCCAGCCCACCATCC
  CCATCGTGGGCATCGTTGCTGGCCTTGTTGTCCTTGGAGCTGTGGTCACTGGAGCTGTGGTCGCTGCTGT
  GATGTGGAGGAAGAAGAGCTCAGATAGAAACAGAGGGAGCTACTCTCAGGCTGCAGCCTACTCAGTGGTC
  AGCGGAAACTTGATGATAACATGGTGGTCAAGCTTATTTCTCCTGGGGGTGCTCTTCCAAGGATATTTGG
  GCTGCCTCCGGAGTCACAGTGTCTTGGGCCGCCGGAAGGTGGGTGACATGTGGATCTTGTTTTTTTTGTG
  GCTGTGGACATCTTTCAACACTGCCTTCTTGGCCTTGCAAAGCCTTCGCTTTGGCTTCGGCTTTAGGAGG
  GGCAGGAGCTTCCTTCTTCGTTCTTGGCACCATCTTATGAAAAGGGTCCAGATTAAGATTTTTGACTGA
  
  
• Restriction Sites: SgfI-RsrII
• ACCN: NM_001098479
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001098479.1, NP_001091949.1
• RefSeq Size: 1591 bp
• RefSeq ORF: 1329 bp
• Locus ID: 3134
• Cytogenetics: 6p22.1
• Protein Families: Transmembrane
• Protein Pathways: Allograft rejection, Antigen processing and presentation, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Endocytosis, Graft-versus-host disease, Type I diabetes mellitus, Viral myocarditis
• Gene Summary: 'This gene belongs to the HLA class I heavy chain paralogues. It encodes a non-classical heavy chain that forms a heterodimer with a beta-2 microglobulin light chain, with the heavy chain anchored in the membrane. Unlike most other HLA heavy chains, this molecule is localized in the endoplasmic reticulum and Golgi apparatus, with a small amount present at the cell surface in some cell types. It contains a divergent peptide-binding groove, and is thought to bind a restricted subset of peptides for immune presentation. This gene exhibits few polymorphisms. Multiple transcript variants encoding different isoforms have been found for this gene. These variants lack a coding exon found in transcripts from other HLA paralogues due to an altered splice acceptor site, resulting in a shorter cytoplasmic domain. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest protein (isoform 1).