PAK3 (NM_002578) Human Untagged Clone
CAT#: SC316402
PAK3 (untagged)-Human p21 protein (Cdc42/Rac)-activated kinase 3 (PAK3), transcript variant 2
"NM_002578" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PAK3 |
Synonyms | ARA; beta-PAK; bPAK; MRX30; MRX47; OPHN3; PAK-3; PAK3beta |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_002578, the custom clone sequence may differ by one or more nucleotides
ATGTCTGACGGTCTGGATAATGAAGAGAAACCCCCGGCTCCTCCACTGAGGATGAATAGT AACAACCGGGATTCTTCAGCACTCAACCACAGCTCCAAACCACTTCCCATGGCCCCTGAA GAGAAGAATAAGAAAGCCAGGCTTCGCTCTATCTTCCCAGGAGGAGGGGATAAAACCAAT AAGAAGAAGGAGAAAGAGCGCCCAGAGATCTCTCTTCCTTCAGACTTTGAGCATACGATT CATGTGGGGTTTGATGCAGTCACCGGGGAATTCACTGGAATTCCAGAGCAATGGGCACGA TTACTCCAAACTTCCAACATAACAAAATTGGAACAGAAGAAGAACCCACAAGCTGTTCTA GATGTTCTCAAATTCTATGATTCCAAAGAAACAGTCAACAACCAGAAATACATGAGCTTT ACATCAGGAGATAAAAGTGCACATGGATACATAGCAGCCCATCCTTCGAGTACAAAAACA GCATCTGAGCCTCCATTGGCCCCTCCTGTGTCTGAAGAAGAAGATGAAGAGGAAGAAGAA GAAGAAGATGAAAATGAGCCACCACCAGTTATCGCACCAAGACCAGAGCATACAAAATCA ATCTATACTCGTTCTGTGGTTGAATCCATTGCTTCACCAGCAGTACCAAATAAAGAGGTC ACACCACCCTCTGCTGAAAATGCCAATTCCAGTACTTTGTACAGGAACACAGATCGGCAA AGAAAAAAATCCAAGATGACAGATGAGGAGATCTTAGAGAAGCTAAGAAGCATTGTGAGT GTTGGGGACCCAAAGAAAAAATACACAAGATTTGAAAAAATTGGTCAAGGGGCATCAGGT ACTGTTTATACAGCACTAGACATTGCAACAGGACAAGAGGTGGCCATAAAGCAGATGAAC CTTCAACAGCAACCCAAGAAGGAATTAATTATTAATGAAATTCTGGTCATGAGGGAAAAT AAGAACCCTAATATTGTTAATTATTTAGATAGCTACTTGGTGGGTGATGAACTATGGGTA GTCATGGAATACTTGGCTGGTGGCTCTCTGACTGATGTGGTCACAGAGACCTGTATGGAT GAAGGACAGATAGCAGCTGTCTGCAGAGAGTGCCTGCAAGCTTTGGATTTCCTGCACTCA AACCAGGTGATCCATAGAGATATAAAGAGTGACAATATTCTTCTCGGGATGGATGGCTCT GTTAAATTGACTGACTTTGGGTTCTGTGCCCAGATCACTCCTGAGCAAAGTAAACGAAGC ACTATGGTGGGAACCCCATATTGGATGGCACCTGAGGTGGTGACTCGAAAAGCTTATGGT CCGAAAGTTGATATCTGGTCTCTTGGAATTATGGCAATTGAAATGGTGGAAGGTGAACCC CCTTACCTTAATGAAAATCCACTCAGGGCATTGTATCTGATAGCCACTAATGGAACTCCA GAGCTCCAGAATCCTGAGAGACTGTCAGCTGTATTCCGTGACTTTTTAAATCGCTGTCTT GAGATGGATGTGGATAGGCGAGGATCTGCCAAGGAGCTTTTGCAGCATCCATTTTTAAAA TTAGCCAAGCCTCTCTCCAGCCTGACTCCTCTGATTATCGCTGCAAAGGAAGCAATTAAG AACAGCAGCCGC |
Restriction Sites | Please inquire |
ACCN | NM_002578 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002578.2, NP_002569.1 |
RefSeq Size | 2516 bp |
RefSeq ORF | 1635 bp |
Locus ID | 5063 |
Cytogenetics | Xq23 |
Domains | PBD, pkinase, TyrKc, S_TKc |
Protein Families | Druggable Genome, Protein Kinase, Stem cell - Pluripotency |
Protein Pathways | Axon guidance, ErbB signaling pathway, Focal adhesion, Regulation of actin cytoskeleton, Renal cell carcinoma, T cell receptor signaling pathway |
Gene Summary | 'The protein encoded by this gene is a serine-threonine kinase and forms an activated complex with GTP-bound RAS-like (P21), CDC2 and RAC1. This protein may be necessary for dendritic development and for the rapid cytoskeletal reorganization in dendritic spines associated with synaptic plasticity. Defects in this gene are the cause of a non-syndromic form of X-linked intellectual disability. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2017]' Transcript Variant: This variant (2) represents use of an alternate promoter compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC323702 | PAK3 (untagged)-Kinase deficient mutant (K261M) of Human p21 protein (Cdc42/Rac)-activated kinase 3 (PAK3), transcript variant 2 |
USD 1,012.00 |
|
RC222595 | PAK3 (Myc-DDK-tagged)-Human p21 protein (Cdc42/Rac)-activated kinase 3 (PAK3), transcript variant 2 |
USD 500.00 |
|
RG222595 | PAK3 (GFP-tagged) - Human p21 protein (Cdc42/Rac)-activated kinase 3 (PAK3), transcript variant 2 |
USD 550.00 |
|
RC222595L3 | Lenti-ORF clone of PAK3 (Myc-DDK-tagged)-Human p21 protein (Cdc42/Rac)-activated kinase 3 (PAK3), transcript variant 2 |
USD 700.00 |
|
RC222595L4 | Lenti-ORF clone of PAK3 (mGFP-tagged)-Human p21 protein (Cdc42/Rac)-activated kinase 3 (PAK3), transcript variant 2 |
USD 700.00 |
{0} Product Review(s)
Be the first one to submit a review