PAK3 (NM_002578) Human Untagged Clone

CAT#: SC316402

PAK3 (untagged)-Human p21 protein (Cdc42/Rac)-activated kinase 3 (PAK3), transcript variant 2


  "NM_002578" in other vectors (5)

Reconstitution Protocol

SC316402 is the updated version of SC118563.

USD 920.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PAK3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PAK3
Synonyms ARA; beta-PAK; bPAK; MRX30; MRX47; OPHN3; PAK-3; PAK3beta
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_002578, the custom clone sequence may differ by one or more nucleotides
ATGTCTGACGGTCTGGATAATGAAGAGAAACCCCCGGCTCCTCCACTGAGGATGAATAGT
AACAACCGGGATTCTTCAGCACTCAACCACAGCTCCAAACCACTTCCCATGGCCCCTGAA
GAGAAGAATAAGAAAGCCAGGCTTCGCTCTATCTTCCCAGGAGGAGGGGATAAAACCAAT
AAGAAGAAGGAGAAAGAGCGCCCAGAGATCTCTCTTCCTTCAGACTTTGAGCATACGATT
CATGTGGGGTTTGATGCAGTCACCGGGGAATTCACTGGAATTCCAGAGCAATGGGCACGA
TTACTCCAAACTTCCAACATAACAAAATTGGAACAGAAGAAGAACCCACAAGCTGTTCTA
GATGTTCTCAAATTCTATGATTCCAAAGAAACAGTCAACAACCAGAAATACATGAGCTTT
ACATCAGGAGATAAAAGTGCACATGGATACATAGCAGCCCATCCTTCGAGTACAAAAACA
GCATCTGAGCCTCCATTGGCCCCTCCTGTGTCTGAAGAAGAAGATGAAGAGGAAGAAGAA
GAAGAAGATGAAAATGAGCCACCACCAGTTATCGCACCAAGACCAGAGCATACAAAATCA
ATCTATACTCGTTCTGTGGTTGAATCCATTGCTTCACCAGCAGTACCAAATAAAGAGGTC
ACACCACCCTCTGCTGAAAATGCCAATTCCAGTACTTTGTACAGGAACACAGATCGGCAA
AGAAAAAAATCCAAGATGACAGATGAGGAGATCTTAGAGAAGCTAAGAAGCATTGTGAGT
GTTGGGGACCCAAAGAAAAAATACACAAGATTTGAAAAAATTGGTCAAGGGGCATCAGGT
ACTGTTTATACAGCACTAGACATTGCAACAGGACAAGAGGTGGCCATAAAGCAGATGAAC
CTTCAACAGCAACCCAAGAAGGAATTAATTATTAATGAAATTCTGGTCATGAGGGAAAAT
AAGAACCCTAATATTGTTAATTATTTAGATAGCTACTTGGTGGGTGATGAACTATGGGTA
GTCATGGAATACTTGGCTGGTGGCTCTCTGACTGATGTGGTCACAGAGACCTGTATGGAT
GAAGGACAGATAGCAGCTGTCTGCAGAGAGTGCCTGCAAGCTTTGGATTTCCTGCACTCA
AACCAGGTGATCCATAGAGATATAAAGAGTGACAATATTCTTCTCGGGATGGATGGCTCT
GTTAAATTGACTGACTTTGGGTTCTGTGCCCAGATCACTCCTGAGCAAAGTAAACGAAGC
ACTATGGTGGGAACCCCATATTGGATGGCACCTGAGGTGGTGACTCGAAAAGCTTATGGT
CCGAAAGTTGATATCTGGTCTCTTGGAATTATGGCAATTGAAATGGTGGAAGGTGAACCC
CCTTACCTTAATGAAAATCCACTCAGGGCATTGTATCTGATAGCCACTAATGGAACTCCA
GAGCTCCAGAATCCTGAGAGACTGTCAGCTGTATTCCGTGACTTTTTAAATCGCTGTCTT
GAGATGGATGTGGATAGGCGAGGATCTGCCAAGGAGCTTTTGCAGCATCCATTTTTAAAA
TTAGCCAAGCCTCTCTCCAGCCTGACTCCTCTGATTATCGCTGCAAAGGAAGCAATTAAG
AACAGCAGCCGC
Restriction Sites Please inquire     
ACCN NM_002578
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002578.2, NP_002569.1
RefSeq Size 2516 bp
RefSeq ORF 1635 bp
Locus ID 5063
Cytogenetics Xq23
Domains PBD, pkinase, TyrKc, S_TKc
Protein Families Druggable Genome, Protein Kinase, Stem cell - Pluripotency
Protein Pathways Axon guidance, ErbB signaling pathway, Focal adhesion, Regulation of actin cytoskeleton, Renal cell carcinoma, T cell receptor signaling pathway
Gene Summary 'The protein encoded by this gene is a serine-threonine kinase and forms an activated complex with GTP-bound RAS-like (P21), CDC2 and RAC1. This protein may be necessary for dendritic development and for the rapid cytoskeletal reorganization in dendritic spines associated with synaptic plasticity. Defects in this gene are the cause of a non-syndromic form of X-linked intellectual disability. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2017]'
Transcript Variant: This variant (2) represents use of an alternate promoter compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.