INO80C (NM_001098817) Human Untagged Clone
CAT#: SC316489
INO80C (untagged)-Human INO80 complex subunit C (INO80C), transcript variant 1
"NM_001098817" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | INO80C |
Synonyms | C18orf37; hIes6; IES6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001098817, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCGCAAATTCCAATTGTGGCCACCACTTCCACTCCCGGAATAGTCCGGAACAGCAAGAAGAGGC CGGCCAGCCCTTCCCACAATGGCAGCAGCGGCGGGGGCTATGGCGCCAGTAAGAAGAAAAAAGCGTCCGC TTCCAGCTTTGCGCAGACGTGCCTTTCGCCTTCCACCATGATTGTGAGGCCTCCCCAGCCACGTGGAACT ACGTGCCTCTTGCCTTCCGCCATGATTGTGAGGCCTCCCCAGCCGCGTGGAAATGGTATCAGCATGGAAG CCATGAGTGAGAATAAAATGGTGCCCTCTGAGTTTAGCACAGGACCTGTGGAAAAAGCTGCCAAACCTTT GCCATTTAAGGATCCCAACTTTGTGCACTCTGGCCACGGTGGCGCAGTAGCTGGCAAGAAGAACAGAACC TGGAAGAACCTGAAACAAATCCTCGCTTCTGAAAGGGCATTGCCGTGGCAACTGAACGATCCTAACTACT TCAGTATTGATGCTCCTCCATCCTTTAAGCCAGCTAAGAAGTATTCTGATGTTTCAGGTCTGCTTGCCAA CTACACAGACCCCCAGAGCAAACTGCGGTTCAGCACCATTGAAGAGTTTTCCTACATTCGGAGGCTGCCC TCTGACGTCGTCACCGGCTACCTGGCCCTGAGGAAGGCCACGAGCATCGTTCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001098817 |
ORF Size | 687 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001098817.1, NP_001092287.1 |
RefSeq Size | 1095 |
RefSeq ORF | 687 |
Locus ID | 125476 |
Gene Summary | Proposed core component of the chromatin remodeling INO80 complex which is involved in transcriptional regulation, DNA replication and probably DNA repair. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221456 | INO80C (Myc-DDK-tagged)-Human INO80 complex subunit C (INO80C), transcript variant 1 |
USD 420.00 |
|
RG221456 | INO80C (GFP-tagged) - Human INO80 complex subunit C (INO80C), transcript variant 1 |
USD 460.00 |
|
RC221456L3 | Lenti ORF clone of Human INO80 complex subunit C (INO80C), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC221456L4 | Lenti ORF clone of Human INO80 complex subunit C (INO80C), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review