INO80C (NM_001098817) Human Untagged Clone

CAT#: SC316489

INO80C (untagged)-Human INO80 complex subunit C (INO80C), transcript variant 1


  "NM_001098817" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "INO80C"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol INO80C
Synonyms C18orf37; hIes6; IES6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001098817, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGCAAATTCCAATTGTGGCCACCACTTCCACTCCCGGAATAGTCCGGAACAGCAAGAAGAGGC
CGGCCAGCCCTTCCCACAATGGCAGCAGCGGCGGGGGCTATGGCGCCAGTAAGAAGAAAAAAGCGTCCGC
TTCCAGCTTTGCGCAGACGTGCCTTTCGCCTTCCACCATGATTGTGAGGCCTCCCCAGCCACGTGGAACT
ACGTGCCTCTTGCCTTCCGCCATGATTGTGAGGCCTCCCCAGCCGCGTGGAAATGGTATCAGCATGGAAG
CCATGAGTGAGAATAAAATGGTGCCCTCTGAGTTTAGCACAGGACCTGTGGAAAAAGCTGCCAAACCTTT
GCCATTTAAGGATCCCAACTTTGTGCACTCTGGCCACGGTGGCGCAGTAGCTGGCAAGAAGAACAGAACC
TGGAAGAACCTGAAACAAATCCTCGCTTCTGAAAGGGCATTGCCGTGGCAACTGAACGATCCTAACTACT
TCAGTATTGATGCTCCTCCATCCTTTAAGCCAGCTAAGAAGTATTCTGATGTTTCAGGTCTGCTTGCCAA
CTACACAGACCCCCAGAGCAAACTGCGGTTCAGCACCATTGAAGAGTTTTCCTACATTCGGAGGCTGCCC
TCTGACGTCGTCACCGGCTACCTGGCCCTGAGGAAGGCCACGAGCATCGTTCCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001098817
ORF Size 687 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001098817.1, NP_001092287.1
RefSeq Size 1095
RefSeq ORF 687
Locus ID 125476
Gene Summary Proposed core component of the chromatin remodeling INO80 complex which is involved in transcriptional regulation, DNA replication and probably DNA repair. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.