CLEC1B (NM_001099431) Human Untagged Clone

CAT#: SC316674

CLEC1B (untagged)-Human C-type lectin domain family 1, member B (CLEC1B), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLEC1B
• Synonyms: 1810061I13Rik; CLEC2; CLEC2B; PRO1384; QDED721
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001099431, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGGATGAAGATGGATACATCACCTTAAATATTAAAACTCGGAAACCAGCTCTCATCTCCGCTGTCA
  TGCAGCGCAATTACCTACAAGGTGAGAATGAAAATCGCACAGGAACTCTGCAACAATTAGCAAAGCGCTT
  CTGTCAATATGTGGTAAAACAATCAGAACTAAAGGGCACTTTCAAAGGTCATAAATGCAGCCCCTGTGAC
  ACAAACTGGAGATATTATGGAGATAGCTGCTATGGGTTCTTCAGGCACAACTTAACATGGGAAGAGAGTA
  AGCAGTACTGCACTGACATGAATGCTACTCTCCTGAAGATTGACAACCGGAACATTGTGGAGTACATCAA
  AGCCAGGACTCATTTAATTCGTTGGGTCGGATTATCTCGCCAGAAGTCGAATGAGGTCTGGAAGTGGGAG
  GATGGCTCGGTTATCTCAGAAAATATGTTTGAGTTTTTGGAAGATGGAAAAGGAAATATGAATTGTGCTT
  ATTTTCATAATGGGAAAATGCACCCTACCTTCTGTGAGAACAAACATTATTTAATGTGTGAGAGGAAGGC
  TGGCATGACCAAGGTGGACCAACTACCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001099431
• ORF Size: 591 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001099431.1, NP_001092901.1
• RefSeq Size: 883
• RefSeq ORF: 591
• Locus ID: 51266
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: Natural killer (NK) cells express multiple calcium-dependent (C-type) lectin-like receptors, such as CD94 (KLRD1; MIM 602894) and NKG2D (KLRC4; MIM 602893), that interact with major histocompatibility complex class I molecules and either inhibit or activate cytotoxicity and cytokine secretion. CLEC2 is a C-type lectin-like receptor expressed in myeloid cells and NK cells (Colonna et al., 2000 [PubMed 10671229]). [supplied by OMIM, Jan 2011]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a.