CLEC1B (NM_001099431) Human Untagged Clone

CAT#: SC316674

CLEC1B (untagged)-Human C-type lectin domain family 1, member B (CLEC1B), transcript variant 2


  "NM_001099431" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CLEC1B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CLEC1B
Synonyms 1810061I13Rik; CLEC2; CLEC2B; PRO1384; QDED721
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001099431, the custom clone sequence may differ by one or more nucleotides


ATGCAGGATGAAGATGGATACATCACCTTAAATATTAAAACTCGGAAACCAGCTCTCATCTCCGCTGTCA
TGCAGCGCAATTACCTACAAGGTGAGAATGAAAATCGCACAGGAACTCTGCAACAATTAGCAAAGCGCTT
CTGTCAATATGTGGTAAAACAATCAGAACTAAAGGGCACTTTCAAAGGTCATAAATGCAGCCCCTGTGAC
ACAAACTGGAGATATTATGGAGATAGCTGCTATGGGTTCTTCAGGCACAACTTAACATGGGAAGAGAGTA
AGCAGTACTGCACTGACATGAATGCTACTCTCCTGAAGATTGACAACCGGAACATTGTGGAGTACATCAA
AGCCAGGACTCATTTAATTCGTTGGGTCGGATTATCTCGCCAGAAGTCGAATGAGGTCTGGAAGTGGGAG
GATGGCTCGGTTATCTCAGAAAATATGTTTGAGTTTTTGGAAGATGGAAAAGGAAATATGAATTGTGCTT
ATTTTCATAATGGGAAAATGCACCCTACCTTCTGTGAGAACAAACATTATTTAATGTGTGAGAGGAAGGC
TGGCATGACCAAGGTGGACCAACTACCTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001099431
ORF Size 591 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001099431.1, NP_001092901.1
RefSeq Size 883
RefSeq ORF 591
Locus ID 51266
Protein Families Druggable Genome, Transmembrane
Gene Summary Natural killer (NK) cells express multiple calcium-dependent (C-type) lectin-like receptors, such as CD94 (KLRD1; MIM 602894) and NKG2D (KLRC4; MIM 602893), that interact with major histocompatibility complex class I molecules and either inhibit or activate cytotoxicity and cytokine secretion. CLEC2 is a C-type lectin-like receptor expressed in myeloid cells and NK cells (Colonna et al., 2000 [PubMed 10671229]). [supplied by OMIM, Jan 2011]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.