XRCC3 (NM_001100119) Human Untagged Clone
CAT#: SC316727
XRCC3 (untagged)-Human X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant 1
"NM_001100119" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | XRCC3 |
| Synonyms | CMM6 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001100119, the custom clone sequence may differ by one or more nucleotides
ATGGATTTGGATCTACTGGACCTGAATCCCAGAATTATTGCTGCAATTAAGAAAGCCAAACTGAAATCGG TAAAGGAGGTTTTACACTTTTCTGGACCAGACTTGAAGAGACTGACCAACCTCTCCAGCCCCGAGGTCTG GCACTTGCTGAGAACGGCCTCCTTACACTTGCGGGGAAGCAGCATCCTTACAGCACTGCAGCTGCACCAG CAGAAGGAGCGGTTCCCCACGCAGCACCAGCGCCTGAGCCTGGGCTGCCCGGTGCTGGACGCGCTGCTCC GCGGTGGCCTGCCCCTGGACGGCATCACTGAGCTGGCCGGACGCAGCTCGGCAGGGAAGACCCAGCTGGC GCTGCAGCTCTGCCTGGCTGTGCAGTTCCCGCGGCAGCACGGAGGCCTGGAGGCTGGAGCCGTCTACATC TGCACGGAAGACGCCTTCCCGCACAAGCGCCTGCAGCAGCTCATGGCCCAGCAGCCGCGGCTGCGCACTG ACGTTCCAGGAGAGCTGCTTCAGAAGCTCCGATTTGGCAGCCAGATCTTCATCGAGCACGTGGCCGATGT GGACACCTTGTTGGAGTGTGTGAATAAGAAGGTCCCCGTACTGCTGTCTCGGGGCATGGCTCGCCTGGTG GTCATCGACTCGGTGGCAGCCCCATTCCGCTGTGAATTTGACAGCCAGGCCTCCGCCCCCAGGGCCAGGC ATCTGCAGTCCCTGGGGGCCACGCTGCGTGAGCTGAGCAGTGCCTTCCAGAGCCCTGTGCTGTGCATCAA CCAGGTGACAGAGGCCATGGAGGAGCAGGGCGCAGCACACGGGCCGCTGGGGTTCTGGGACGAACGTGTT TCCCCAGCCCTTGGCATAACCTGGGCTAACCAGCTCCTGGTGAGACTGCTGGCTGACCGGCTCCGCGAGG AAGAGGCTGCCCTCGGCTGCCCAGCCCGGACCCTGCGGGTGCTCTCTGCCCCCCACCTGCCCCCCTCCTC CTGTTCCTACACGATCAGTGCCGAAGGGGTGCGAGGGACACCTGGGACCCAGTCCCACTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001100119 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001100119.1, NP_001093589.1 |
| RefSeq Size | 2657 bp |
| RefSeq ORF | 1041 bp |
| Locus ID | 7517 |
| Cytogenetics | 14q32.33 |
| Protein Families | Druggable Genome |
| Protein Pathways | Homologous recombination |
| Gene Summary | 'This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster irs1SF, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and is chromosomally unstable. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214791 | XRCC3 (Myc-DDK-tagged)-Human X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant 1 |
USD 457.00 |
|
| RG214791 | XRCC3 (GFP-tagged) - Human X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant 1 |
USD 460.00 |
|
| RC214791L3 | Lenti ORF clone of Human X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
| RC214791L4 | Lenti ORF clone of Human X-ray repair complementing defective repair in Chinese hamster cells 3 (XRCC3), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China