CYP11A1 (NM_001099773) Human Untagged Clone
CAT#: SC316732
CYP11A1 (untagged)-Human cytochrome P450, family 11, subfamily A, polypeptide 1 (CYP11A1), transcript variant 2
"NM_001099773" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CYP11A1 |
Synonyms | CYP11A; CYPXIA1; P450SCC |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001099773, the custom clone sequence may differ by one or more nucleotides
ATGGCTCCAGAGGCCACCAAGAACTTTTTGCCCCTGTTGGATGCAGTGTCTCGGGACTTC GTCAGTGTCCTGCACAGGCGCATCAAGAAGGCGGGCTCCGGAAATTACTCGGGGGACATC AGTGATGACCTGTTCCGCTTTGCCTTTGAGTCCATCACTAACGTCATTTTTGGGGAGCGC CAGGGGATGCTGGAGGAAGTAGTGAACCCCGAGGCCCAGCGATTCATTGATGCCATCTAC CAGATGTTCCACACCAGCGTCCCCATGCTCAACCTTCCCCCAGACCTGTTCCGTCTGTTC AGGACCAAGACCTGGAAGGACCATGTGGCTGCATGGGACGTGATTTTCAGTAAAGCTGAC ATATACACCCAGAACTTCTACTGGGAATTGAGACAGAAAGGAAGTGTTCACCACGATTAC CGTGGCATCCTCTACAGACTCCTGGGAGACAGCAAGATGTCCTTCGAGGACATCAAGGCC AACGTCACAGAGATGCTGGCAGGAGGGGTGGACACGACGTCCATGACCCTGCAGTGGCAC TTGTATGAGATGGCACGCAACCTGAAGGTGCAGGATATGCTGCGGGCAGAGGTCTTGGCT GCGCGGCACCAGGCCCAGGGAGACATGGCCACGATGCTACAGCTGGTCCCCCTCCTCAAA GCCAGCATCAAGGAGACACTAAGACTTCACCCCATCTCCGTGACCCTGCAGAGATATCTT GTAAATGACTTGGTTCTTCGAGATTACATGATTCCTGCCAAGACACTGGTGCAAGTGGCC ATCTATGCTCTGGGCCGAGAGCCCACCTTCTTCTTCGACCCGGAAAATTTTGACCCAACC CGATGGCTGAGCAAAGACAAGAACATCACCTACTTCCGGAACTTGGGCTTTGGCTGGGGT GTGCGGCAGTGTCTGGGACGGCGGATCGCTGAGCTAGAGATGACCATCTTCCTCATCAAT ATGCTGGAGAACTTCAGAGTTGAAATCCAACACCTCAGCGATGTGGGCACCACATTCAAC CTCATTCTGATGCCTGAAAAGCCCATCTCCTTCACCTTCTGGCCCTTTAACCAGGAAGCA ACCCAGCAG |
Restriction Sites | Please inquire |
ACCN | NM_001099773 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001099773.1, NP_001093243.1 |
RefSeq Size | 2010 bp |
RefSeq ORF | 1092 bp |
Locus ID | 1583 |
Cytogenetics | 15q24.1 |
Protein Families | Druggable Genome, P450 |
Protein Pathways | C21-Steroid hormone metabolism, Metabolic pathways |
Gene Summary | 'This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and catalyzes the conversion of cholesterol to pregnenolone, the first and rate-limiting step in the synthesis of the steroid hormones. Two transcript variants encoding different isoforms have been found for this gene. The cellular location of the smaller isoform is unclear since it lacks the mitochondrial-targeting transit peptide. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (2) uses an alternate first exon compared to variant 1, resulting in the translation start site being located at a downstream AUG. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211728 | CYP11A1 (Myc-DDK-tagged)-Human cytochrome P450, family 11, subfamily A, polypeptide 1 (CYP11A1), transcript variant 2 |
USD 420.00 |
|
RG211728 | CYP11A1 (GFP-tagged) - Human cytochrome P450, family 11, subfamily A, polypeptide 1 (CYP11A1), transcript variant 2 |
USD 460.00 |
|
RC211728L3 | Lenti-ORF clone of CYP11A1 (Myc-DDK-tagged)-Human cytochrome P450, family 11, subfamily A, polypeptide 1 (CYP11A1), transcript variant 2 |
USD 620.00 |
|
RC211728L4 | Lenti-ORF clone of CYP11A1 (mGFP-tagged)-Human cytochrome P450, family 11, subfamily A, polypeptide 1 (CYP11A1), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review