SVIP (NM_148893) Human Untagged Clone

CAT#: SC316887

SVIP (untagged)-Human small VCP/p97-interacting protein (SVIP)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SVIP
• Synonyms: DKFZp313A2432
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_148893, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGCTGTGTTTTCCTTGTCCCGGGGAGTCCGCGCCTCCCACGCCGGACCTGGAAGAGAAAAGAGCAA
  AGCTTGCAGAGGCTGCAGAGAGAAGACAAAAAGAGGCTGCATCTCGGGGAATTTTAGATGTTCAATCTGT
  GCAAGAAAAGAGAAAGAAAAAGGAAAAAATAGAAAAACAAATTGCTACATCCGGGCCCCCACCAGAAGGT
  GGACTTAGGTGGACAGTTTCATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_148893
• ORF Size: 234 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_148893.2, NP_683691.1
• RefSeq Size: 3204
• RefSeq ORF: 234
• Locus ID: 258010
• Gene Summary: Endoplasmic reticulum-associated degradation (ERAD) is the pathway by which misfolded proteins in the endoplasmic reticulum are targeted to the proteasome for degradation. Multiple specialized proteins interact with one another during ERAD to complete this process. The protein encoded by this gene is an inhibitor of ERAD, functioning to disrupt the interaction of these protein components. This downregulation of ERAD may be needed to protect the cell from overactive protein degradation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
  Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.