CSAG1 (NM_001102576) Human Untagged Clone
CAT#: SC316888
CSAG1 (untagged)-Human chondrosarcoma associated gene 1 (CSAG1), transcript variant c
"NM_001102576" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CSAG1 |
Synonyms | CSAGE; CT24.1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001102576, the custom clone sequence may differ by one or more nucleotides
ATGTCGGCGACTACAGCCTGCTGGCCTGCCTTCACTGTCCTGGGGGAAGCTCGGGGAGACCAGGTGGACT GGAGTAGACTGTACAGAGACACTGGTCTGGTGAAGATGTCCAGGAAACCACGAGCCTCCAGCCCATTTTC CAACAACCACCCATCAACACCAAAGAGGTTCCCAAGACAACCCAGAAGGGAAAAGGGACCCGTCAAGGAA GTTCCAGGAACAAAAGGCTCTCCCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001102576 |
ORF Size | 237 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001102576.2, NP_001096046.2 |
RefSeq Size | 670 |
RefSeq ORF | 237 |
Locus ID | 158511 |
Gene Summary | This gene encodes a member of a family of tumor antigens. The protein is expressed in chondrosarcomas, but may also be expressed in normal tissues such as testis. Alternative splicing of this gene results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (c) differs in the 5' UTR compared to variant a. Variants a and c both encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220996 | CSAG1 (Myc-DDK-tagged)-Human chondrosarcoma associated gene 1 (CSAG1), transcript variant c |
USD 420.00 |
|
RG220996 | CSAG1 (GFP-tagged) - Human chondrosarcoma associated gene 1 (CSAG1), transcript variant c |
USD 460.00 |
|
RC220996L1 | Lenti ORF clone of Human chondrosarcoma associated gene 1 (CSAG1), transcript variant c, Myc-DDK-tagged |
USD 768.00 |
|
RC220996L2 | Lenti ORF clone of Human chondrosarcoma associated gene 1 (CSAG1), transcript variant c, mGFP tagged |
USD 620.00 |
|
RC220996L3 | Lenti ORF clone of Human chondrosarcoma associated gene 1 (CSAG1), transcript variant c, Myc-DDK-tagged |
USD 620.00 |
|
RC220996L4 | Lenti ORF clone of Human chondrosarcoma associated gene 1 (CSAG1), transcript variant c, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review