CSAG1 (NM_001102576) Human Untagged Clone

CAT#: SC316888

CSAG1 (untagged)-Human chondrosarcoma associated gene 1 (CSAG1), transcript variant c


  "NM_001102576" in other vectors (6)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CSAG1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CSAG1
Synonyms CSAGE; CT24.1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001102576, the custom clone sequence may differ by one or more nucleotides


ATGTCGGCGACTACAGCCTGCTGGCCTGCCTTCACTGTCCTGGGGGAAGCTCGGGGAGACCAGGTGGACT
GGAGTAGACTGTACAGAGACACTGGTCTGGTGAAGATGTCCAGGAAACCACGAGCCTCCAGCCCATTTTC
CAACAACCACCCATCAACACCAAAGAGGTTCCCAAGACAACCCAGAAGGGAAAAGGGACCCGTCAAGGAA
GTTCCAGGAACAAAAGGCTCTCCCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001102576
ORF Size 237 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001102576.2, NP_001096046.2
RefSeq Size 670
RefSeq ORF 237
Locus ID 158511
Gene Summary This gene encodes a member of a family of tumor antigens. The protein is expressed in chondrosarcomas, but may also be expressed in normal tissues such as testis. Alternative splicing of this gene results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (c) differs in the 5' UTR compared to variant a. Variants a and c both encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.