TMEM273 (NM_001010863) Human Untagged Clone
CAT#: SC316892
C10orf128 (untagged)-Human chromosome 10 open reading frame 128 (C10orf128)
"NM_001010863" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TMEM273 |
Synonyms | C10orf128 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001010863 edited
ATGAACTTGGGGGTCAGCATGCTGAGGATCCTCTTCCTCCTGGATGTAGGAGGAGCTCAA GTGCTGGCAACAGGCAAGACCCCTGGGGCTGAAATTGATTTCAAGTACGCCCTCATCGGG ACTGCTGTGGGTGTCGCCATATCTGCTGGCTTCCTGGCCCTGAAGATCTGCATGATCAGG AGGCACTTATTTGACGACGACTCTTCCGACCTGAAAAGCACGCCTGGGGGCCTCAGTGAC ACCATCCCGCTAAAGAAGAGAGCCCCAAGGCGAAACCACAATTTCTCCAAAAGAGATGCA CAGGTGATTGAGCTGTAG |
Restriction Sites | Please inquire |
ACCN | NM_001010863 |
ORF Size | 318 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001010863.1. |
Reference Data | |
RefSeq | NM_001010863.1, NP_001010863.1 |
RefSeq Size | 384 |
RefSeq ORF | 318 |
Locus ID | 170371 |
Protein Families | Transmembrane |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217459 | C10orf128 (Myc-DDK-tagged)-Human chromosome 10 open reading frame 128 (C10orf128) |
USD 420.00 |
|
RG217459 | C10orf128 (GFP-tagged) - Human chromosome 10 open reading frame 128 (C10orf128) |
USD 460.00 |
|
RC217459L3 | Lenti ORF clone of Human chromosome 10 open reading frame 128 (C10orf128), Myc-DDK-tagged |
USD 620.00 |
|
RC217459L4 | Lenti ORF clone of Human chromosome 10 open reading frame 128 (C10orf128), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review