TMEM273 (NM_001010863) Human Untagged Clone

CAT#: SC316892

C10orf128 (untagged)-Human chromosome 10 open reading frame 128 (C10orf128)


  "NM_001010863" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "TMEM273"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TMEM273
Synonyms C10orf128
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001010863 edited
ATGAACTTGGGGGTCAGCATGCTGAGGATCCTCTTCCTCCTGGATGTAGGAGGAGCTCAA
GTGCTGGCAACAGGCAAGACCCCTGGGGCTGAAATTGATTTCAAGTACGCCCTCATCGGG
ACTGCTGTGGGTGTCGCCATATCTGCTGGCTTCCTGGCCCTGAAGATCTGCATGATCAGG
AGGCACTTATTTGACGACGACTCTTCCGACCTGAAAAGCACGCCTGGGGGCCTCAGTGAC
ACCATCCCGCTAAAGAAGAGAGCCCCAAGGCGAAACCACAATTTCTCCAAAAGAGATGCA
CAGGTGATTGAGCTGTAG
Restriction Sites Please inquire     
ACCN NM_001010863
ORF Size 318 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001010863.1.
Reference Data
RefSeq NM_001010863.1, NP_001010863.1
RefSeq Size 384
RefSeq ORF 318
Locus ID 170371
Protein Families Transmembrane

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.