RIPPLY1 (NM_138382) Human Untagged Clone
CAT#: SC316900
RIPPLY1 (untagged)-Human ripply1 homolog (zebrafish) (RIPPLY1), transcript variant 1
"NM_138382" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RIPPLY1 |
Synonyms | ripply1 homolog; ripply1 homolog (zebrafish); RP11-321G1.2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_138382, the custom clone sequence may differ by one or more nucleotides
ATGGACTCTGCTGCCTGTGCTGCTGCTGCCACCCCTGTTCCAGCCCTGGCTTTGGCCCTAGCTCCAGACC TAGCACAAGCCCCACTGGCACTCCCTGGCCTGTTAAGCCCATCTTGCCTTCTCTCCTCTGGACAAGAAGT AAATGGGAGTGAAAGAGGAACTTGTCTCTGGAGGCCCTGGCTGTCTTCCACAAATGACTCCCCAAGGCAG ATGAGGAAGCTGGTGGATTTGGCTGCTGGTGGGGCAACGGCTGCTGAGGTCACCAAGGCTGAATCCAAGT TCCATCACCCTGTCAGGCTCTTCTGGCCTAAATCCCGCTCCTTCGACTATCTGTACAGTGCTGGGGAGAT TTTACTGCAGAACTTTCCTGTCCAGGCAACCATCAACCTATACGAGGACTCAGACAGCGAAGAAGAAGAG GAAGATGAAGAGCAGGAGGATGAAGAAGAGAAGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_138382 |
ORF Size | 456 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_138382.2, NP_612391.1 |
RefSeq Size | 1206 |
RefSeq ORF | 456 |
Locus ID | 92129 |
Gene Summary | This gene encodes a protein similar to a zebrafish protein which acts as a transcriptional repressor in and is required for somite segmentation in zebrafish embryos (PMID: 16326386). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213774 | RIPPLY1 (Myc-DDK-tagged)-Human ripply1 homolog (zebrafish) (RIPPLY1), transcript variant 1 |
USD 98.00 |
|
RG213774 | RIPPLY1 (GFP-tagged) - Human ripply1 homolog (zebrafish) (RIPPLY1), transcript variant 1 |
USD 460.00 |
|
RC213774L1 | Lenti ORF clone of Human ripply1 homolog (zebrafish) (RIPPLY1), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC213774L2 | Lenti ORF clone of Human ripply1 homolog (zebrafish) (RIPPLY1), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC213774L3 | Lenti ORF clone of Human ripply1 homolog (zebrafish) (RIPPLY1), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC213774L4 | Lenti ORF clone of Human ripply1 homolog (zebrafish) (RIPPLY1), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review