CENPM (NM_001110215) Human Untagged Clone

CAT#: SC317005

CENPM (untagged)-Human centromere protein M (CENPM), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CENPM
• Synonyms: C22orf18; CENP-M; PANE1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001110215, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCCGAGTGTGGGACTTGCCTGGTGTGCTCAAGGTGGAAGGCTTTAGGGCCACCATGGCGCAGCGCC
  TGGTGCGCGTGCTGCAGATCTGTGCTGGCCACGTGCCCGGTGTCTCAGCTCTGAACCTGCTGTCCCTGCT
  GAGAAGCTCTGAGGGCCCCTCCCTGGAGGACCTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001110215
• ORF Size: 177 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001110215.2, NP_001103685.1
• RefSeq Size: 557
• RefSeq ORF: 177
• Locus ID: 79019
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene is an inner protein of the kinetochore, the multi-protein complex that binds spindle microtubules to regulate chromosome segregation during cell division. It belongs to the constitutive centromere-associated network protein group, whose members interact with outer kinetochore proteins and help to maintain centromere identity at each cell division cycle. The protein is structurally related to GTPases but cannot bind guanosine triphosphate. A point mutation that affects interaction with another constitutive centromere-associated network protein, CENP-I, impairs kinetochore assembly and chromosome alignment, suggesting that it is required for kinetochore formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
  Transcript Variant: This variant (3) has a distinct 5' UTR and lacks a portion of the 5' coding region compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (c) with a shorter N-terminus compared to isoform a.