Activin A Receptor Type IC (ACVR1C) (NM_001111033) Human Untagged Clone
CAT#: SC317193
ACVR1C (untagged)-Human activin A receptor, type IC (ACVR1C), transcript variant 4
"NM_001111033" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ACVR1C |
Synonyms | ACVRLK7; ALK7 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001111033, the custom clone sequence may differ by one or more nucleotides
ATGACCCGGGCGCTCTGCTCAGCGCTCCGCCAGGCTCTCCTGCTGCTCGCAGCGGCCGCCGAGCTCTCGC CAGGACTGAAGTGTGTATGTCTTTTGTGTGATTCTTCAAACTTTACCTGCCAAACAGAAGGAGCATGTTG GGCATCAGTCATGCTAACCAATGGAAAAGAGCAGGTGATCAAATCCTGTGTCTCCCTTCCAGAACTGAAT GCTCAAGTCTTCTGTCATAGTTCCAACAATGTTACCAAAACCGAATGCTGCTTCACAGATTTTTGCAACA ACATAACACTGCACCTTCCAACAGATAATGGAACTTGGACTCAACTTTGGCTGGTATCTGAATATCATGA ACAGGGCTCCTTATATGACTATTTGAATAGAAATATAGTGACCGTGGCTGGAATGATCAAGCTGGCGCTC TCAATTGCTAGTGGTCTGGCACACCTTCATATGGAGATTGTTGGTACACAAGGTAAACCTGCTATTGCTC ATCGAGACATAAAATCAAAGAATATCTTAGTGAAAAAGTGTGAAACTTGTGCCATAGCGGACTTAGGGTT GGCTGTGAAGCATGATTCAATACTGAACACTATCGACATACCTCAGAATCCTAAAGTGGGAACCAAGAGG TATATGGCTCCTGAAATGCTTGATGATACAATGAATGTGAATATCTTTGAGTCCTTCAAACGAGCTGACA TCTATTCTGTTGGTCTGGTTTACTGGGAAATAGCCCGGAGGTGTTCAGTCGGAGGAATTGTTGAGGAGTA CCAATTGCCTTATTATGACATGGTGCCTTCAGATCCCTCGATAGAGGAAATGAGAAAGGTTGTTTGTGAC CAGAAGTTTCGACCAAGTATCCCAAACCAGTGGCAAAGTTGTGAAGCACTCCGAGTCATGGGGAGAATAA TGCGTGAGTGTTGGTATGCCAACGGAGCGGCCCGCCTAACTGCTCTTCGTATTAAGAAGACTATATCTCA ACTTTGTGTCAAAGAAGACTGCAAAGCCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001111033 |
ORF Size | 1011 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001111033.1, NP_001104503.1 |
RefSeq Size | 8421 |
RefSeq ORF | 1011 |
Locus ID | 130399 |
Protein Families | Druggable Genome, Protein Kinase, Transmembrane |
Protein Pathways | Adherens junction, Chronic myeloid leukemia, Colorectal cancer, Endocytosis, MAPK signaling pathway, Pancreatic cancer, Pathways in cancer, TGF-beta signaling pathway |
Gene Summary | ACVR1C is a type I receptor for the TGFB (see MIM 190180) family of signaling molecules. Upon ligand binding, type I receptors phosphorylate cytoplasmic SMAD transcription factors, which then translocate to the nucleus and interact directly with DNA or in complex with other transcription factors (Bondestam et al., 2001 [PubMed 12063393]). [supplied by OMIM, Mar 2008] Transcript Variant: This variant (4) lacks two alternate in-frame exons in the coding region, compared to variant 1. The resulting isoform (4), also known as sALK7b, lacks the transmembrane domain, GS domain, and part of the kinase domain, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225494 | ACVR1C (Myc-DDK-tagged)-Human activin A receptor, type IC (ACVR1C), transcript variant 4 |
USD 420.00 |
|
RG225494 | ACVR1C (GFP-tagged) - Human activin A receptor, type IC (ACVR1C), transcript variant 4 |
USD 460.00 |
|
RC225494L3 | Lenti ORF clone of Human activin A receptor, type IC (ACVR1C), transcript variant 4, Myc-DDK-tagged |
USD 620.00 |
|
RC225494L4 | Lenti ORF clone of Human activin A receptor, type IC (ACVR1C), transcript variant 4, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review