Activin A Receptor Type IC (ACVR1C) (NM_001111033) Human Untagged Clone

CAT#: SC317193

ACVR1C (untagged)-Human activin A receptor, type IC (ACVR1C), transcript variant 4


  "NM_001111033" in other vectors (4)

Reconstitution Protocol

USD 580.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ACVR1C"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ACVR1C
Synonyms ACVRLK7; ALK7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001111033, the custom clone sequence may differ by one or more nucleotides


ATGACCCGGGCGCTCTGCTCAGCGCTCCGCCAGGCTCTCCTGCTGCTCGCAGCGGCCGCCGAGCTCTCGC
CAGGACTGAAGTGTGTATGTCTTTTGTGTGATTCTTCAAACTTTACCTGCCAAACAGAAGGAGCATGTTG
GGCATCAGTCATGCTAACCAATGGAAAAGAGCAGGTGATCAAATCCTGTGTCTCCCTTCCAGAACTGAAT
GCTCAAGTCTTCTGTCATAGTTCCAACAATGTTACCAAAACCGAATGCTGCTTCACAGATTTTTGCAACA
ACATAACACTGCACCTTCCAACAGATAATGGAACTTGGACTCAACTTTGGCTGGTATCTGAATATCATGA
ACAGGGCTCCTTATATGACTATTTGAATAGAAATATAGTGACCGTGGCTGGAATGATCAAGCTGGCGCTC
TCAATTGCTAGTGGTCTGGCACACCTTCATATGGAGATTGTTGGTACACAAGGTAAACCTGCTATTGCTC
ATCGAGACATAAAATCAAAGAATATCTTAGTGAAAAAGTGTGAAACTTGTGCCATAGCGGACTTAGGGTT
GGCTGTGAAGCATGATTCAATACTGAACACTATCGACATACCTCAGAATCCTAAAGTGGGAACCAAGAGG
TATATGGCTCCTGAAATGCTTGATGATACAATGAATGTGAATATCTTTGAGTCCTTCAAACGAGCTGACA
TCTATTCTGTTGGTCTGGTTTACTGGGAAATAGCCCGGAGGTGTTCAGTCGGAGGAATTGTTGAGGAGTA
CCAATTGCCTTATTATGACATGGTGCCTTCAGATCCCTCGATAGAGGAAATGAGAAAGGTTGTTTGTGAC
CAGAAGTTTCGACCAAGTATCCCAAACCAGTGGCAAAGTTGTGAAGCACTCCGAGTCATGGGGAGAATAA
TGCGTGAGTGTTGGTATGCCAACGGAGCGGCCCGCCTAACTGCTCTTCGTATTAAGAAGACTATATCTCA
ACTTTGTGTCAAAGAAGACTGCAAAGCCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001111033
ORF Size 1011 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001111033.1, NP_001104503.1
RefSeq Size 8421
RefSeq ORF 1011
Locus ID 130399
Protein Families Druggable Genome, Protein Kinase, Transmembrane
Protein Pathways Adherens junction, Chronic myeloid leukemia, Colorectal cancer, Endocytosis, MAPK signaling pathway, Pancreatic cancer, Pathways in cancer, TGF-beta signaling pathway
Gene Summary ACVR1C is a type I receptor for the TGFB (see MIM 190180) family of signaling molecules. Upon ligand binding, type I receptors phosphorylate cytoplasmic SMAD transcription factors, which then translocate to the nucleus and interact directly with DNA or in complex with other transcription factors (Bondestam et al., 2001 [PubMed 12063393]). [supplied by OMIM, Mar 2008]
Transcript Variant: This variant (4) lacks two alternate in-frame exons in the coding region, compared to variant 1. The resulting isoform (4), also known as sALK7b, lacks the transmembrane domain, GS domain, and part of the kinase domain, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.