C19orf12 (NM_031448) Human Untagged Clone
CAT#: SC317241
C19orf12 (untagged)-Human chromosome 19 open reading frame 12 (C19orf12), transcript variant 2
"NM_031448" in other vectors (7)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | C19orf12 |
Synonyms | MPAN; NBIA3; NBIA4; SPG43 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_031448, the custom clone sequence may differ by one or more nucleotides
ATGACTATCATGGTGGAGGACATCATGAAGCTGCTGTGCTCCCTTTCTGGGGAGAGGAAGATGAAGGCGG CTGTCAAGCACTCTGGGAAGGGTGCCCTGGTCACAGGGGCCATGGCCTTCGTCGGGGGTTTGGTGGGCGG CCCACCGGGACTCGCCGTTGGGGGGGCTGTCGGGGGGCTGTTAGGTGCCTGGATGACAAGTGGACAGTTT AAGCCGGTTCCTCAGATCCTAATGGAGCTGCCCCCTGCCGAGCAACAGAGGCTCTTTAACGAAGCCGCAG CCATCATCAGGCACCTGGAGTGGACGGACGCCGTGCAGCTGACCGCGCTGGTCATGGGCAGCGAGGCCCT GCAGCAGCAGCTGCTGGCCATGCTGGTGAACTACGTCACCAAGGAGCTGCGGGCCGAGATCCAGTATGAT GACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_031448 |
ORF Size | 426 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_031448.4, NP_113636.2 |
RefSeq Size | 4683 |
RefSeq ORF | 426 |
Locus ID | 83636 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a small transmembrane protein. Mutations in this gene are a cause of neurodegeneration with brain iron accumulation-4 (NBIA4), but the specific function of the encoded protein is unknown. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (2) differs in the 5' UTR and initiates translation at a downstream, in-frame start codon, compared to variant 1. Variants 2 and 4 encode the same isoform (2), which has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC127755 | C19orf12 (untagged)-Human chromosome 19 open reading frame 12 (C19orf12), transcript variant 2 |
USD 420.00 |
|
RC223171 | C19orf12 (Myc-DDK-tagged)-Human chromosome 19 open reading frame 12 (C19orf12), transcript variant 2 |
USD 420.00 |
|
RG223171 | C19orf12 (GFP-tagged) - Human chromosome 19 open reading frame 12 (C19orf12), transcript variant 2 |
USD 460.00 |
|
RC223171L1 | Lenti ORF clone of Human chromosome 19 open reading frame 12 (C19orf12), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC223171L2 | Lenti ORF clone of Human chromosome 19 open reading frame 12 (C19orf12), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC223171L3 | Lenti ORF clone of Human chromosome 19 open reading frame 12 (C19orf12), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC223171L4 | Lenti ORF clone of Human chromosome 19 open reading frame 12 (C19orf12), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review