TM2D2 (NM_031940) Human Untagged Clone

CAT#: SC317267

TM2D2 (untagged)-Human TM2 domain containing 2 (TM2D2), transcript variant 2


  "NM_031940" in other vectors (5)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TM2D2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TM2D2
Synonyms BLP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_031940, the custom clone sequence may differ by one or more nucleotides


ATGAAGAAATGTCTTTTGCCCGTTTTGATTACGTGCATGCAAACAGCGATTTGCAAAGACCGTATGATGA
TGATCATGATCTTACTGGTGAATTACAGACCTGATGAATTTATAGAATGTGAAGACCCAGTGGATCATGT
TGGAAATGCAACTGCATCCCAGGAACTTGGTTATGGTTGTCTCAAGTTCGGCGGTCAGGCCTACAGCGAC
GTGGAACACACTTCAGTCCAGTGCCATGCCTTAGATGGAATTGAGTGTGCCAGTCCTAGGACCTTTCTAC
GAGAAAATAAACCTTGTATAAAGTATACCGGACACTACTTCATAACCACTTTACTCTACTCCTTCTTCCT
GGGATGTTTTGGTGTGGATCGATTCTGTTTGGGACACACTGGCACTGCAGTAGGGAAGCTGTTGACGCTT
GGAGGACTTGGGATTTGGTGGTTTGTTGACCTTATTTTGCTAATTACTGGAGGGCTGATGCCAAGTGATG
GCAGCAACTGGTGCACTGTTTACTAA


Restriction Sites SgfI-MluI     
ACCN NM_031940
ORF Size 516 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_031940.3, NP_114146.3
RefSeq Size 3641
RefSeq ORF 516
Locus ID 83877
Domains TM2
Protein Families Druggable Genome, Transmembrane
Gene Summary The protein encoded by this gene contains a structural module related to that of the seven transmembrane domain G protein-coupled receptor superfamily. This protein has sequence and structural similarities to the beta-amyloid binding protein (BBP), but, unlike BBP, it does not regulate a response to beta-amyloid peptide. This protein may have regulatory roles in cell death or proliferation signal cascades. This gene has multiple alternatively spliced transcript variants which encode two different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (b) is shorter and has a distinct N-terminus compared to isoform a. Variants 2, 3, and 4 all encode isoform b.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.