TM2D2 (NM_031940) Human Untagged Clone
CAT#: SC317267
TM2D2 (untagged)-Human TM2 domain containing 2 (TM2D2), transcript variant 2
"NM_031940" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TM2D2 |
Synonyms | BLP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_031940, the custom clone sequence may differ by one or more nucleotides
ATGAAGAAATGTCTTTTGCCCGTTTTGATTACGTGCATGCAAACAGCGATTTGCAAAGACCGTATGATGA TGATCATGATCTTACTGGTGAATTACAGACCTGATGAATTTATAGAATGTGAAGACCCAGTGGATCATGT TGGAAATGCAACTGCATCCCAGGAACTTGGTTATGGTTGTCTCAAGTTCGGCGGTCAGGCCTACAGCGAC GTGGAACACACTTCAGTCCAGTGCCATGCCTTAGATGGAATTGAGTGTGCCAGTCCTAGGACCTTTCTAC GAGAAAATAAACCTTGTATAAAGTATACCGGACACTACTTCATAACCACTTTACTCTACTCCTTCTTCCT GGGATGTTTTGGTGTGGATCGATTCTGTTTGGGACACACTGGCACTGCAGTAGGGAAGCTGTTGACGCTT GGAGGACTTGGGATTTGGTGGTTTGTTGACCTTATTTTGCTAATTACTGGAGGGCTGATGCCAAGTGATG GCAGCAACTGGTGCACTGTTTACTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_031940 |
ORF Size | 516 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_031940.3, NP_114146.3 |
RefSeq Size | 3641 |
RefSeq ORF | 516 |
Locus ID | 83877 |
Domains | TM2 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | The protein encoded by this gene contains a structural module related to that of the seven transmembrane domain G protein-coupled receptor superfamily. This protein has sequence and structural similarities to the beta-amyloid binding protein (BBP), but, unlike BBP, it does not regulate a response to beta-amyloid peptide. This protein may have regulatory roles in cell death or proliferation signal cascades. This gene has multiple alternatively spliced transcript variants which encode two different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (b) is shorter and has a distinct N-terminus compared to isoform a. Variants 2, 3, and 4 all encode isoform b. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC106725 | TM2D2 (untagged)-Human TM2 domain containing 2 (TM2D2), transcript variant 2 |
USD 420.00 |
|
RC202598 | TM2D2 (Myc-DDK-tagged)-Human TM2 domain containing 2 (TM2D2), transcript variant 2 |
USD 98.00 |
|
RG202598 | TM2D2 (GFP-tagged) - Human TM2 domain containing 2 (TM2D2), transcript variant 2 |
USD 460.00 |
|
RC202598L3 | Lenti ORF clone of Human TM2 domain containing 2 (TM2D2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC202598L4 | Lenti ORF clone of Human TM2 domain containing 2 (TM2D2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review