LCN10 (NM_001001712) Human Untagged Clone
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LCN10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001001712, the custom clone sequence may differ by one or more nucleotides
ATGAGGCAGGGGCTGCTGGTGCTGGCGCTGGTGCTGGTGCTGGTGCTAGTGCTGGCTGCAGGGTCCCAGG TGCAGGAGTGGTACCCCAGGGAGTCCCACGCCCTCAACTGGAACAAGTTTTCAGGGTTCTGGTACATTCT GGCCACTGCCACTGATGCCCAGGGATTCTTGCCGGCCAGGGACAAGAGGAAGCTGGGGGCGTCCGTGGTA AAGGTGAACAAAGTGGGCCAGCTCCGCGTGCTCCTCGCCTTCAGACGGTTGAAGGGGTGCCAGTCCCAGG AGGTGATCCTGAGGAAAGACGGGAAGAAGCCGGTGTTTGGGAACGCCTGTGCATACGCGGCGGGCCCGAG GGAAGGACAGGAGGGAGTGAAAGGGGTGAAGGCCTTCCACGTGCTGTCCACTGACTACAGCTACGGCTTG GTCTACCTCCGCCTGGGGCGTGCAACCCAAAACTACAAGAACCTGCTGCTCTTCCATAGGCAGAATGTTT CGAGCTTCCAGAGTCTGAAGGAATTCATGGACGCTTGTGACATTCTGGGGCTCTCCAAGGCCGCCGTCAT CCTCCCGAAAGACGCGTCCCGTACACACACCATCCTGCCATGA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001001712 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001001712.2, NP_001001712.2 |
RefSeq Size | 2047 bp |
RefSeq ORF | 603 bp |
Locus ID | 414332 |
Cytogenetics | 9q34.3 |
Protein Families | Secreted Protein, Transmembrane |
Gene Summary | Members of the lipocalin family, such as LCN10, have a common structure consisting of an 8-stranded antiparallel beta-barrel that forms a cup-shaped ligand-binding pocket or calyx. Lipocalins generally bind small hydrophobic ligands and transport them to specific cells (Suzuki et al., 2004 [PubMed 15363845]). [supplied by OMIM, Aug 2009] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217246 | LCN10 (Myc-DDK-tagged)-Human lipocalin 10 (LCN10) |
USD 98.00 |
|
RG217246 | LCN10 (GFP-tagged) - Human lipocalin 10 (LCN10) |
USD 460.00 |
|
RC217246L1 | Lenti ORF clone of Human lipocalin 10 (LCN10), Myc-DDK-tagged |
USD 620.00 |
|
RC217246L2 | Lenti ORF clone of Human lipocalin 10 (LCN10), mGFP tagged |
USD 620.00 |
|
RC217246L3 | Lenti ORF clone of Human lipocalin 10 (LCN10), Myc-DDK-tagged |
USD 620.00 |
|
RC217246L4 | Lenti ORF clone of Human lipocalin 10 (LCN10), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review