NBL1 (NM_182744) Human Untagged Clone

CAT#: SC317320

NBL1 (untagged)-Human neuroblastoma, suppression of tumorigenicity 1 (NBL1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NBL1
• Synonyms: D1S1733E; DAN; DAND1; NB; NO3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_182744, the custom clone sequence may differ by one or more nucleotides
  ATGCCCGGCAACCTCATGAGTCAGACAAGCAGGGCTGTGTCTATCTGGAAGTTTCCAGCC
  AAGCTAGGTAAAACACATGGACACAGGGCTCTGGAGGCCACGGGCATGATGCTTCGGGTC
  CTGGTGGGGGCTGTCCTCCCTGCCATGCTACTGGCTGCCCCACCACCCATCAACAAGCTG
  GCACTGTTCCCAGATAAGAGTGCCTGGTGCGAAGCCAAGAACATCACCCAGATCGTGGGC
  CACAGCGGCTGTGAGGCCAAGTCCATCCAGAACAGGGCGTGCCTAGGACAGTGCTTCAGC
  TACAGCGTCCCCAACACCTTCCCACAGTCCACAGAGTCCCTGGTTCACTGTGACTCCTGC
  ATGCCAGCCCAGTCCATGTGGGAGATTGTGACGCTGGAGTGCCCGGGCCACGAGGAGGTG
  CCCAGGGTGGACAAGCTGGTGGAGAAGATCCTGCACTGTAGCTGCCAGGCCTGCGGCAAG
  GAGCCTAGTCACGAGGGGCTGAGCGTCTATGTGCAGGGCGAGGACGGGCCGGGATCCCAG
  CCCGGCACCCACCCTCACCCCCATCCCCACCCCCATCCTGGCGGGCAGACCCCTGAGCCC
  GAGGACCCCCCTGGGGCCCCCCACACAGAGGAAGAGGGGGCTGAGGAC
  
• Restriction Sites: Please inquire
• ACCN: NM_182744
• Insert Size: 2079 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_182744.2, NP_877421.2
• RefSeq Size: 2079 bp
• RefSeq ORF: 2079 bp
• Locus ID: 4681
• Cytogenetics: 1p36.13
• Protein Families: Secreted Protein
• Gene Summary: 'This gene product is the founding member of the evolutionarily conserved CAN (Cerberus and DAN) family of proteins, which contain a domain resembling the CTCK (C-terminal cystine knot-like) motif found in a number of signaling molecules. These proteins are secreted, and act as BMP (bone morphogenetic protein) antagonists by binding to BMPs and preventing them from interacting with their receptors. They may thus play an important role during growth and development. Alternatively spliced transcript variants have been identified for this gene. Read-through transcripts between this locus and the upstream mitochondrial inner membrane organizing system 1 gene (GeneID 440574) have been observed. [provided by RefSeq, May 2013]'
  Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.