PEBP4 (NM_144962) Human Untagged Clone

CAT#: SC317329

PEBP4 (untagged)-Human phosphatidylethanolamine-binding protein 4 (PEBP4)


  "NM_144962" in other vectors (5)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PEBP4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PEBP4
Synonyms CORK-1; CORK1; GWTM1933; HEL-S-300; hPEBP4; PEBP-4; PRO4408
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_144962, the custom clone sequence may differ by one or more nucleotides


ATGGGTTGGACAATGAGGCTGGTCACAGCAGCACTGTTACTGGGTCTCATGATGGTGGTCACTGGAGACG
AGGATGAGAACAGCCCGTGTGCCCATGAGGCCCTCTTGGACGAGGACACCCTCTTTTGCCAGGGCCTTGA
AGTTTTCTACCCAGAGTTGGGGAACATTGGCTGCAAGGTTGTTCCTGATTGTAACAACTACAGACAGAAG
ATCACCTCCTGGATGGAGCCGATAGTCAAGTTCCCGGGGGCCGTGGACGGCGCAACCTATATCCTGGTGA
TGGTGGATCCAGATGCCCCTAGCAGAGCAGAACCCAGACAGAGATTCTGGAGACATTGGCTGGTAACAGA
TATCAAGGGCGCCGACCTGAAGAAAGGGAAGATTCAGGGCCAGGAGTTATCAGCCTACCAGGCTCCCTCC
CCACCGGCACACAGTGGCTTCCATCGCTACCAGTTCTTTGTCTATCTTCAGGAAGGAAAAGTCATCTCTC
TCCTTCCCAAGGAAAACAAAACTCGAGGCTCTTGGAAAATGGACAGATTTCTGAACCGTTTCCACCTGGG
CGAACCTGAAGCAAGCACCCAGTTCATGACCCAGAACTACCAGGACTCACCAACCCTCCAGGCTCCCAGA
GAAAGGGCCAGCGAGCCCAAGCACAAAAACCAGGCGGAGATAGCTGCCTGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_144962
ORF Size 684 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_144962.2, NP_659399.2
RefSeq Size 901
RefSeq ORF 684
Locus ID 157310
Gene Summary The phosphatidylethanolamine (PE)-binding proteins, including PEBP4, are an evolutionarily conserved family of proteins with pivotal biologic functions, such as lipid binding and inhibition of serine proteases (Wang et al., 2004 [PubMed 15302887]). [supplied by OMIM, Dec 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.