CNOT7 (NM_054026) Human Untagged Clone
CAT#: SC317350
CNOT7 (untagged)-Human CCR4-NOT transcription complex, subunit 7 (CNOT7), transcript variant 2
"NM_054026" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CNOT7 |
Synonyms | CAF-1; CAF1; Caf1a; hCAF-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_054026, the custom clone sequence may differ by one or more nucleotides
ATGCCAGCGGCAACTGTAGATCATAGCCAAAGAATTTGTGAAGTTTGGGCTTGCAACTTGGATGAAGAGA TGAAGAAAATTCGTCAAGTTATCCGAAAATATAATTACGTTGCTATGGACACCGAGTTTCCAGGTGTGGT TGCAAGACCCATTGGAGAATTCAGGAGCAATGCTGACTATCAATACCAACTATTGCGGTGTAATGTAGAC TTGTTAAAGATAATTCAGCTAGGACTGACATTTATGAATGAGCAAGGAGAATACCCTCCAGGAACTTCAA CTTGGCAGTTTAATTTTAAATTTAATTTGACGGAGGACATGTATGCCCAGGACTCTATAGAGCTACTAAC AACATCTGGTATCCAGTTTAAAAAACATGAGGAGGAAGGAATTGAAACCCAGTACTTTGCAGAACTTCTT ATGACTTCTGGAGTGGTCCTCTGTGAAGGGGTCAAATGGTTGTCATTTCATAGCGGTTACGACTTTGGCT ACTTAATCAAAATCCTAACCAACTCTAACTTGCCTGAAGAAGAACTTGACTTCTTTGAGATCCTTCGATT GTTTTTTCCTGTCATTTATGATGTGAAGTACCTCATGAAGAGCTGCAAAAATCTCAAAGGTGGATTACAG GAGGTGGCAGAACAGTTAGAGCTGGAACGGATAGGACCACAACATCAGGCAGGATCTGATTCATTGCTCA CAGGAATGGCCTTTTTCAAAATGAGAGAAGTATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_054026 |
ORF Size | 735 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_054026.3, NP_473367.2 |
RefSeq Size | 1990 |
RefSeq ORF | 735 |
Locus ID | 29883 |
Domains | CAF1 |
Protein Families | Transcription Factors |
Protein Pathways | RNA degradation |
Gene Summary | The protein encoded by this gene binds to an anti-proliferative protein, B-cell translocation protein 1, which negatively regulates cell proliferation. Binding of the two proteins, which is driven by phosphorylation of the anti-proliferative protein, causes signaling events in cell division that lead to changes in cell proliferation associated with cell-cell contact. The encoded protein downregulates the innate immune response and therefore provides a therapeutic target for enhancing its antimicrobial activity against foreign agents. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1 and X. [provided by RefSeq, Apr 2016] Transcript Variant: This variant (2) contains an alternate 3' terminal exon and thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct and shorter C-terminus, compared to isoform 1. Variants 2, 3, 4 and 5 all encode isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224954 | CNOT7 (Myc-DDK-tagged)-Human CCR4-NOT transcription complex, subunit 7 (CNOT7), transcript variant 2 |
USD 420.00 |
|
RG224954 | CNOT7 (GFP-tagged) - Human CCR4-NOT transcription complex, subunit 7 (CNOT7), transcript variant 2 |
USD 460.00 |
|
RC224954L3 | Lenti ORF clone of Human CCR4-NOT transcription complex, subunit 7 (CNOT7), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC224954L4 | Lenti ORF clone of Human CCR4-NOT transcription complex, subunit 7 (CNOT7), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review