IDI1 (NM_004508) Human Untagged Clone
CAT#: SC317411
IDI1 (untagged)-Human isopentenyl-diphosphate delta isomerase 1 (IDI1)
"NM_004508" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IDI1 |
Synonyms | IPP1; IPPI1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_004508, the custom clone sequence may differ by one or more nucleotides
ATGTGGCGTGGACTGGCGCTGGCGCGAGCGATTGGCTGCGCGGCCCGGGGGCGGGGCCAGTGGGCGGTGC GCGCCGCAGACTGTGCTCAAAGCGGGCGCCATCCGGGACCGGCGGTTGTCTGTGGCCGGAGGCTGATCAG TGTTCTAGAACAGATCAGACATTTTGTAATGATGCCTGAAATAAACACTAACCACCTCGACAAGCAACAG GTTCAACTCCTGGCAGAGATGTGTATCCTTATTGATGAAAATGACAATAAAATTGGAGCTGAGACCAAGA AGAATTGTCACCTGAACGAGAACATTGAGAAAGGATTATTGCATCGAGCTTTTAGTGTCTTCTTATTCAA CACCGAAAATAAGCTTCTGCTACAGCAAAGATCAGATGCTAAGATTACCTTTCCAGGTTGTTTTACGAAT ACGTGTTGTAGTCATCCATTAAGCAATCCAGCCGAGCTTGAGGAAAGTGACGCCCTTGGAGTGAGGCGAG CAGCACAGAGACGGCTGAAAGCTGAGCTAGGAATTCCCTTGGAAGAGGTTCCTCCAGAAGAAATTAATTA TTTAACACGAATTCACTACAAAGCTCAGTCTGATGGTATCTGGGGTGAACATGAAATTGATTACATTTTG TTGGTGAGGAAGAATGTAACTTTGAATCCAGATCCCAATGAGATTAAAAGCTATTGTTATGTGTCAAAGG AAGAACTAAAAGAACTTCTGAAAAAAGCAGCCAGTGGTGAAATTAAGATAACGCCATGGTTTAAAATTAT TGCAGCGACTTTTCTCTTTAAATGGTGGGATAACTTAAATCATTTGAATCAGTTTGTTGACCATGAGAAA ATATACAGAATGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_004508 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004508.3, NP_004499.2 |
RefSeq Size | 2996 bp |
RefSeq ORF | 855 bp |
Locus ID | 3422 |
Cytogenetics | 10p15.3 |
Domains | NUDIX |
Protein Pathways | Metabolic pathways, Terpenoid backbone biosynthesis |
Gene Summary | 'IDI1 encodes a peroxisomally-localized enzyme that catalyzes the interconversion of isopentenyl diphosphate (IPP) to its highly electrophilic isomer, dimethylallyl diphosphate (DMAPP), which are the substrates for the successive reaction that results in the synthesis of farnesyl diphosphate and, ultimately, cholesterol. It has been shown in peroxisomal deficiency diseases such as Zellweger syndrome and neonatal adrenoleukodystrophy that there is reduction in IPP isomerase activity. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (1) encodes the longest isoform (a). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC117309 | IDI1 (untagged)-Human isopentenyl-diphosphate delta isomerase 1 (IDI1) |
USD 660.00 |
|
RC214341 | IDI1 (Myc-DDK-tagged)-Human isopentenyl-diphosphate delta isomerase 1 (IDI1) |
USD 420.00 |
|
RG214341 | IDI1 (GFP-tagged) - Human isopentenyl-diphosphate delta isomerase 1 (IDI1) |
USD 460.00 |
|
RC214341L1 | Lenti ORF clone of Human isopentenyl-diphosphate delta isomerase 1 (IDI1), Myc-DDK-tagged |
USD 768.00 |
|
RC214341L2 | Lenti ORF clone of Human isopentenyl-diphosphate delta isomerase 1 (IDI1), mGFP tagged |
USD 620.00 |
|
RC214341L3 | Lenti ORF clone of Human isopentenyl-diphosphate delta isomerase 1 (IDI1), Myc-DDK-tagged |
USD 620.00 |
|
RC214341L4 | Lenti ORF clone of Human isopentenyl-diphosphate delta isomerase 1 (IDI1), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review