MED8 (NM_052877) Human Untagged Clone

CAT#: SC317443

MED8 (untagged)-Human mediator complex subunit 8 (MED8), transcript variant 3


  "NM_052877" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MED8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MED8
Synonyms ARC32
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_052877, the custom clone sequence may differ by one or more nucleotides


ATGCAGAGAGAGGAGAAGCAGCTTGAGGCATCATTAGATGCACTGCTGAGTCAAGTGGCTGATCTGAAGA
ACTCTCTGGGGAGTTTCATTTGCAAGTTGGAGAACGAGTATGGCCGGCTGACCTGGCCATCTGTCCTGGA
CAGCTTTGCCTTGCTTTCTGGACAGCTGAACACTCTGAACAAGGTCTTGAAGCATGAAAAAACACCGCTG
TTCCGTAACCAGGTCATCATTCCTCTGGTGTTGTCTCCAGACCGAGATGAAGATCTCATGCGGCAGACTG
AAGGACGGGTGCCTGTTTTCAGCCATGAGGTAGTCCCTGACCATCTGAGAACCAAGCCTGACCCTGAAGT
GGAAGAACAGGAGAAGCAACTGACGACAGATGCTGCCCGCATTGGTGCAGATGCAGCCCAGAAGCAGATC
CAGAGCTTGAATAAAATGTGTTCAAACCTTCTGGAGAAAATCAGCAAAGAGGAGCGAGAATCAGAGAGTG
GAGGTCTCCGGCCGAACAAGCAGACCTTTAACCCTACAGACACTAATGCCTTGGTGGCAGCTGTTGCCTT
TGGGAAAGGACTATCTAATTGGAGACCTTCAGGCAGCAGTGGTCCTGGCCAGGCAGGCCAGCCAGGAGCT
GGGACGATCCTTGCAGGAACCTCAGGATTACAGCAGGTGCAGATGGCAGGAGCTCCAAGCCAGCAGCAGC
CAATGCTCAGTGGGGTACAAATGGCTCAGGCAGGTCAACCAGGGAAAATGCCAAGTGGAATAAAAACCAA
CATCAAGTCGGCTTCCATGCATCCCTACCAGCGGCCCTCCTGCCTGGGTTTCATTCTGGCTATCCCTCTA
AGGCGCAAGGTGAAGAAGCTTCTGGGCCAGGAAGGAAAAAAAAATGCCCACCTGCAGCTCTGGTGA


Restriction Sites SgfI-MluI     
ACCN NM_052877
ORF Size 906 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_052877.4, NP_443109.2
RefSeq Size 1496
RefSeq ORF 906
Locus ID 112950
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene encodes a protein component of the mediator complex, which aids in transcriptional activation through interaction with RNA polymerase II and gene-specific transcription factors. The encoded protein may also function in ubiquitin ligation and protein degradation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (3) represents the shortest transcript and encodes the longest isoform (3).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.