KIR2DS4 (NM_012314) Human Untagged Clone
CAT#: SC317452
KIR2DS4 (untagged)-Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4 (KIR2DS4)
"NM_012314" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KIR2DS4 |
Synonyms | CD158I; KIR-2DS4; KIR1D; KIR412; KKA3; NKAT-8; NKAT8 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_012314, the custom clone sequence may differ by one or more nucleotides
ATGTCGCTCATGGTCATCATCATGGCGTGTGTTGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACAGGAGG GAGTCCACAGAAAACCTTCCTTCCTGGCCCTCCCAGGTCACCTGGTGAAATCAGAAGAGACAGTCATCCT GCAATGTTGGTCGGATGTCATGTTTGAGCACTTCCTTCTGCACAGAGAGGGGAAGTTTAACAACACTTTG CACCTCATTGGAGAGCACCATGATGGGGTTTCCAAGGCCAACTTCTCCATTGGTCCCATGATGCCTGTCC TTGCAGGAACCTACAGATGCTACGGTTCTGTTCCTCACTCCCCCTATCAGTTGTCAGCTCCCAGTGACCC TCTGGACATGGTGATCATAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTCAG GCAGGAGAGAATGTGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATGTACCATCTATCCAGGGAAG GGGAGGCCCATGAACGTAGGCTCCCTGCAGTGCGCAGCATCAACGGAACATTCCAGGCCGACTTTCCTCT GGGCCCTGCCACCCACGGAGGGACCTACAGATGCTTCGGCTCTTTCCGTGACGCTCCCTACGAGTGGTCA AACTCGAGTGATCCACTGCTTGTTTCCGTCACAGGAAACCCTTCAAATAGTTGGCCTTCACCCACTGAAC CAAGCTCCAAAACCGGTAACCCCAGACACCTACATGTTCTGATTGGGACCTCAGTGGTCAAAATCCCTTT CACCATCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCGACAAAAAAAATGCTGCTGTAATGGACCAA GAGCCTGCAGGGAACAGAACAGTGAACAGCGAGGATTCTGATGAACAAGACCATCAGGAGGTGTCATACG CATAA |
Restriction Sites | Please inquire |
ACCN | NM_012314 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_012314.3, NP_036446.3 |
RefSeq Size | 1586 bp |
RefSeq ORF | 915 bp |
Locus ID | 3809 |
Cytogenetics | 19q13.42 |
Protein Families | Transmembrane |
Protein Pathways | Antigen processing and presentation, Natural killer cell mediated cytotoxicity |
Gene Summary | 'Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (1) represents the functional allele (KIR2DS4*001) and encodes a functional, membrane-bound, activating receptor (isoform 1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223899 | KIR2DS4 (Myc-DDK-tagged)-Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4 (KIR2DS4) |
USD 420.00 |
|
RG223899 | KIR2DS4 (GFP-tagged) - Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4 (KIR2DS4) |
USD 460.00 |
|
RC223899L1 | Lenti-ORF clone of KIR2DS4 (Myc-DDK-tagged)-Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4 (KIR2DS4) |
USD 620.00 |
|
RC223899L2 | Lenti-ORF clone of KIR2DS4 (mGFP-tagged)-Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4 (KIR2DS4) |
USD 768.00 |
|
RC223899L3 | Lenti-ORF clone of KIR2DS4 (Myc-DDK-tagged)-Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4 (KIR2DS4) |
USD 620.00 |
|
RC223899L4 | Lenti-ORF clone of KIR2DS4 (mGFP-tagged)-Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4 (KIR2DS4) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review