RFC3 (NM_181558) Human Untagged Clone

CAT#: SC317454

RFC3 (untagged)-Human replication factor C (activator 1) 3, 38kDa (RFC3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RFC3
• Synonyms: RFC38
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_181558, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCCTCTGGGTGGACAAGTATCGGCCCTGCTCCTTGGGACGGCTGGACTATCACAAGGAGCAGGCGG
  CCCAGCTGCGGAACCTGGTGCAGTGTGGTGACTTTCCTCATCTGTTAGTGTACGGACCATCAGGTGCTGG
  AAAAAAGACAAGAATTATGTGTATTCTACGTGAACTTTATGGTGTTGGAGTGGAAAAATTGAGAATTGAA
  CATCAGACCATCACAACTCCATCTAAAAAAAAAATTGAAATTAGCACCATTGCAAGTAACTACCACCTTG
  AAGTTAATCCTAGTGATGCTGGAAATAGTGACCGAGTAGTCATTCAGGAGATGTTGAAAACAGTGGCACA
  ATCACAACAACTTGAAACAAACTCTCAAAGGGATTTTAAAGTGGTATTATTGACAGAAGTTGACAAACTC
  ACCAAAGATGCTCAGCATGCCTTGCGAAGAACCATGGAAAAATATATGTCTACCTGCAGATTGATCTTGT
  GCTGCAATTCTACATCTAAAGTGATCCCACCTATTCGTAGTAGGTGCTTGGCGGTTCGTGTGCCTGCTCC
  CAGCATTGAAGATATTTGCCACGTGTTATCTACTGTGTGTAAGAAGGAAGGTCTGAATCTTCCTTCACAA
  CTGGCTCATAGACTTGCAGAGAAGTCTTGTAGAAATCTCAGAAAAGCCCTGCTTATGTGTGAAGCCTGCA
  GAGTGCAACAATATCCTTTTACTGCAGATCAAGAAATCCCTGAGACAGATTGGGAGGTGTATCTGAGGGA
  GACTGCAAATGCTATTGTCAGTCAGCAAACTCCACAAAGGCTCCTTGAAGTTCGTGGAAGGCTGTATGAG
  CTTCTAACTCATTGTATTCCTCCTGAGATAATAATGAAGGCATGTAAGGAGGAATCAAGAAGCTGTGACA
  TATTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_181558
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_181558.2, NP_853536.2
• RefSeq Size: 1463 bp
• RefSeq ORF: 918 bp
• Locus ID: 5983
• Cytogenetics: 13q13.2
• Protein Families: Stem cell - Pluripotency
• Protein Pathways: DNA replication, Mismatch repair, Nucleotide excision repair
• Gene Summary: 'The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kDa. This gene encodes the 38 kDa subunit. This subunit is essential for the interaction between the 140 kDa subunit and the core complex that consists of the 36, 37, and 40 kDa subunits. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) differs in the 3' coding region and UTR compared to variant 1. The resulting isoform (2) has a distinct and shorter C-terminus compared to isoform 1.