FUS2 (NAT6) (NM_012191) Human Untagged Clone

CAT#: SC317460

NAT6 (untagged)-Human N-acetyltransferase 6 (GCN5-related) (NAT6), transcript variant 1


  "NM_012191" in other vectors (5)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NAT6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NAT6
Synonyms FUS-2; FUS2; HsNAAA80; NAT6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_012191, the custom clone sequence may differ by one or more nucleotides


ATGCAAGAGCTGACTCTGAGCCCTGGCCCAGCCAAGCTGACCCCTACACTAGACCCTACACACCGGATGG
AGCTGATCCTGAGTACCAGCCCAGCTGAGCTGACTCTGGATCCTGCGTGCCAGCCAAAGCTGCCCCTGGA
TTCCACATGCCAACCAGAGATGACCTTCAATCCTGGTCCAACTGAGCTTACCCTGGATCCTGAACACCAG
CCAGAGGAGACCCCAGCTCCTAGCCTGGCTGAGTTGACCCTGGAGCCTGTGCACCGCCGACCCGAGCTCC
TGGATGCTTGTGCTGACCTCATCAATGATCAGTGGCCCCGCAGCCGCACCTCCCGCCTGCACTCCCTGGG
CCAGTCCTCAGATGCCTTCCCCCTCTGCCTGATGCTGCTAAGCCCCCACCCCACACTTGAAGCAGCACCC
GTTGTGGTGGGCCATGCCCGCCTGTCACGGGTGCTGAACCAGCCCCAGAGCCTCTTAGTGGAGACAGTGG
TGGTGGCCCGGGCCCTGAGGGGCCGTGGCTTTGGCCGCCGCCTCATGGAGGGCCTGGAGGTCTTTGCTCG
GGCCCGGGGCTTCCGCAAGCTGCATCTCACCACCCATGACCAGGTGCACTTCTATACCCACCTGGGCTAC
CAGCTGGGTGAGCCTGTGCAGGGCCTGGTCTTCACCAGCAGACGGCTGCCTGCCACCCTGCTTAATGCCT
TCCCCACAGCCCCCTCTCCCCGGCCACCCAGGAAGGCCCCAAACCTGACTGCCCAAGCTGCCCCAAGGGG
TCCCAAGGGACCTCCATTGCCACCACCCCCTCCCCTACCTGAGTGCCTGACCATCTCACCCCCAGTTCCA
TCAGGGCCCCCTTCAAAAAGCCTGCTGGAGACACAATATCAAAATGTGAGGGGGCGCCCCATATTCTGGA
TGGAAAAAGACATCTGA


Restriction Sites SgfI-MluI     
ACCN NM_012191
ORF Size 927 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_012191.3, NP_036323.2
RefSeq Size 1358
RefSeq ORF 927
Locus ID 24142
Domains Acetyltransf
Protein Pathways Glycerophospholipid metabolism, Limonene and pinene degradation, Phenylalanine metabolism, Tyrosine metabolism
Gene Summary This gene encodes a member of the N-acetyltransferase family. N-acetyltransferases modify proteins by transferring acetyl groups from acetyl CoA to the N-termini of protein substrates. The encoded protein is a cytoplasmic N-acetyltransferase with a substrate specificity for proteins with an N-terminal methionine. This gene is located in the tumor suppressor gene region on chromosome 3p21.3 and the encoded protein may play a role in cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed. This gene overlaps and is on the same strand as hyaluronoglucosaminidase 3, and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (1) encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.