VPS13B (NM_181661) Human Untagged Clone

CAT#: SC317665

VPS13B (untagged)-Human vacuolar protein sorting 13 homolog B (yeast) (VPS13B), transcript variant 4


  "NM_181661" in other vectors (4)

Reconstitution Protocol

USD 700.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "VPS13B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol VPS13B
Synonyms CHS1; COH1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_181661, the custom clone sequence may differ by one or more nucleotides


ATGCTGGAGTCATATGTAACTCCAATTTTAATGAGCTATGTGAATCGCTACATCAAGAACTTAAAGCCGT
CGGATCTACAGCTTTCACTATGGGGTGGAGACGTGGTACTCAGCAAGCTCGAGTTAAAGTTGGATGTGCT
GGAACAGGAACTGAAATTACCATTCACTTTTTTAAGTGGACATATTCATGAATTGAGGATTCATGTACCA
TGGACAAAACTGGGTTCAGAACCAGTGGTAATTACCATCAATACTATGGAATGCATTTTGAAACTTAAGG
ATGGGATACAGGATGACCATGAAAGCTGTGGTTCTAATTCTACCAACCGTAGTACTGCTGAGAGCACAAA
ATCATCAATCAAACCGCGGAGAATGCAGCAGGCTGCTCCTACAGATCCTGACTTACCACCAGGTTATGTG
CAGAGTCTGATTAGACGAGTTGTAAATAATGTAAACATTGTGATAAATAATCTCATACTAAAATATGTTG
AAGATGATATCGTCCTTTCCGTCAATATCACTTCTGCAGAATGTTATACAGTAGGTGAATTATGGGATCG
TGCATTCATGGATATTTCTGCAACTGATTTGGTGCTGAGAAAGGTTATCAATTTTTCTGACTGTACAGTT
TGTCTTGATAAACGGAATGCCAGTGGTAAAATAGAATTTTACCAGGATCCTTTATTATACAAATGTTCCT
TCAGAACTCGTCTTCATTTTACATATGAAAACCTAAATTCCAAGATGCCATCTGTTATTAAAATTCATAC
TTTAGTGGAAAGTTTGAAACTTTCTATCACAGATCAACAACTGCCTATGTTTATTCGTATAATGCAACTT
GGAATTGCTCTTTACTATGGAGAAATAGGCAATTTTAAAGAAGGCGAAATAGAGGACCTTACTTGTCATA
ATAAAGATATGCTAGGAAACATTACAGGTTCTGAAGATGAAACAAGAATAGATATGCAATATCCTGCTCA
GCATAAAGGTCAAGAGTTATATTCACAGCAAGATGAGGAGCAGCCACAGGGATGGGTGTCATGGGCCTGG
TCCTTTGTGCCTGCAATTGTGAGTTATGACGATGGCGAGGAAGACTTTGTTGGGAACGATCCTGCATCAA
CCATGCATCAACAAAAAGCACAGACTTTGAAGGATCCTATTGTTTCTATAGGATTTTATTGCACAAAGGC
AACGGTGACTTTCAAAGTAGGTCTTTTCTCTTGCTGTTTATATCTCTATCAACTTTAA


Restriction Sites SgfI-MluI     
ACCN NM_181661
ORF Size 1248 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_181661.2, NP_858047.2
RefSeq Size 1634
RefSeq ORF 1248
Locus ID 157680
Gene Summary This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) uses an alternate splice site in the coding region, which results in introduction of a stop codon, compared to variant 5. The resulting isoform (4) has a shorter and distinct C-terminus, compared to isoform 5. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.