SEPTIN7 (NM_001011553) Human Untagged Clone

CAT#: SC317714

41524 (untagged)-Human septin 7 (SEPT7), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SEPTIN7
• Synonyms: CDC3; CDC10; NBLA02942; SEPT7; SEPT7A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001011553, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGGTCAGTGCGAGATCCGCTGCTGCTGAGGAGAGGAGCGTCAACAGCAGCACCATGGCTCAACAGA
  AGAACCTTGAAGGCTATGTGGGATTTGCCAATCTCCCAAATCAAGTATACAGAAAATCGGTGAAGAGAGG
  TTTTGAATTCACGCTTATGGTAGTGGGTGAATCTGGATTGGGAAAGTCGACATTAATCAACTCATTATTC
  CTCACAGATTTGTATTCTCCAGAGTATCCAGGTCCTTCTCATAGAATTAAAAAGACTGTACAGGTGGAAC
  AATCCAAAGTTTTAATCAAAGAAGGTGGTGTTCAGTTGCTGCTCACAATAGTTGATACCCCAGGATTTGG
  AGATGCAGTGGATAATAGTAATTGCTGGCAGCCTGTTATCGACTACATTGATAGTAAATTTGAGGACTAC
  CTAAATGCAGAATCACGAGTGAACAGACGTCAGATGCCTGATAACAGGGTGCAGTGTTGTTTATACTTCA
  TTGCTCCTTCAGGACATGGACTTAAACCATTGGATATTGAGTTTATGAAGCGTTTGCATGAAAAAGTGAA
  TATCATCCCACTTATTGCCAAAGCAGACACACTCACACCAGAGGAATGCCAACAGTTTAAAAAACAGATA
  ATGAAAGAAATCCAAGAACATAAAATTAAAATATACGAATTTCCAGAAACAGATGATGAAGAAGAAAATA
  AACTTGTTAAAAAGATAAAGGACCGTTTACCTCTTGCTGTGGTAGGTAGTAATACTATCATTGAAGTTAA
  TGGCAAAAGGGTCAGAGGAAGGCAGTATCCTTGGGGTGTTGCTGAAGTTGAAAATGGTGAACATTGTGAT
  TTTACAATCCTAAGAAATATGTTGATAAGAACACACATGCAGGACTTGAAAGATGTTACTAATAATGTCC
  ACTATGAGAACTACAGAAGCAGAAAACTTGCAGCTGTGACTTATAATGGAGTTGATAACAACAAGAATAA
  AGGGCAGCTGACTAAGAGCCCTCTGGCACAAATGGAAGAAGAAAGAAGGGAGCATGTAGCTAAAATGAAG
  AAGATGGAGATGGAGATGGAGCAGGTGTTTGAGATGAAGGTCAAAGAAAAAGTTCAAAAACTGAAGGACT
  CTGAAGCTGAGCTCCAGCGGCGCCATGAGCAAATGAAAAAGAATTTGGAAGCACAGCACAAAGAATTGGA
  GGAAAAACGTCGTCAGTTCGAGGATGAGAAAGCAAACTGGGAAGCTCAACAACGTATTTTAGAACAACAG
  AACTCTTCAAGAACCTTGGAAAAGAACAAGAAGAAAGGGAAGATCTTTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001011553
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001011553.3, NP_001011553.2
• RefSeq Size: 4377 bp
• RefSeq ORF: 1311 bp
• Locus ID: 989
• Cytogenetics: 7p14.2
• Gene Summary: 'This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. [provided by RefSeq, Jul 2011]'
  Transcript Variant: This variant (2) lacks an in-frame segment in the 5' coding region, compared to variant 1, resulting in an isoform (2) that is 1 aa shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.