TTC19 (NM_017775) Human Untagged Clone
CAT#: SC317843
TTC19 (untagged)-Human tetratricopeptide repeat domain 19 (TTC19), transcript variant 1
"NM_017775" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TTC19 |
Synonyms | 2010204O13Rik; MC3DN2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_017775, the custom clone sequence may differ by one or more nucleotides
ATGTTCCGGCTCCTGAGCTGGAGCCTGGGCCGAGGCTTCCTGCGGGCCGCGGGGCGGCGGTGCCGGGGCT GCTCCGCGCGCCTGCTCCCGGGGCTGGCAGGAGGTCCGGGGCCCGAGGTGCAGGTGCCGCCATCCCGAGT CGCGCCGCACGGCCGGGGCCCAGGCCTGCTGCCGCTGCTGGCAGCGCTCGCCTGGTTCTCGAGGCCCGCT GCGGCAGAGGAGGAGGAGCAGCAGGGAGCCGACGGGGCCGCTGCCGAGGACGGGGCGGACGAGGCCGAGG CAGAGATCATCCAGCTGCTGAAGCGAGCCAAGTTGAGCATTATGAAAGATGAGCCAGAAGAGGCTGAGTT AATTTTGCATGACGCTCTTCGTCTCGCCTATCAGACTGATAACAAGAAGGCCATCACTTACACTTATGAT TTGATGGCCAACTTAGCATTTATACGGGGTCAGCTTGAAAATGCTGAACAACTTTTTAAAGCAACAATGA GTTACCTCCTTGGAGGGGGCATGAAGCAGGAGGACAATGCAATAATTGAAATTTCCCTAAAGCTGGCCAG TATCTATGCTGCGCAGAACAGACAGGAATTTGCTGTTGCTGGCTATGAATTCTGCATTTCAACTCTAGAG GAAAAAATTGAAAGAGAAAAGGAATTAGCAGAAGACATTATGTCAGTGGAAGAGAAAGCCAATACCCACC TCCTCTTGGGCATGTGCTTAGACGCCTGTGCTCGCTACCTTCTGTTCTCCAAGCAGCCGTCACAGGCACA AAGGATGTATGAAAAAGCTCTGCAGATTTCTGAAGAAATACAAGGAGAAAGACACCCACAGACCATTGTG CTGATGAGTGACCTGGCTACTACCCTGGATGCACAGGGCCGCTTTGATGAGGCCTATATTTATATGCAAA GGGCATCAGATCTGGCAAGACAGATAAATCATCCTGAGCTACACATGGTACTCAGTAATCTAGCTGCAGT TTTGATGCACAGAGAACGATATACACAAGCAAAAGAGATCTACCAGGAAGCACTGAAGCAAGCAAAGCTG AAAAAAGATGAAATTTCTGTACAACACATCAGGGAAGAGTTGGCTGAGCTGTCAAAGAAAAGTAGACCTT TGACAAATTCTGTCAAGCTCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_017775 |
ORF Size | 1143 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_017775.3, NP_060245.3 |
RefSeq Size | 3505 |
RefSeq ORF | 1143 |
Locus ID | 54902 |
Domains | TPR |
Gene Summary | This gene encodes a protein with a tetratricopeptide repeat (TPR) domain containing several TPRs of about 34 aa each. These repeats are found in a variety of organisms including bacteria, fungi and plants, and are involved in a variety of functions including protein-protein interactions. This protein is embedded in the inner mitochondrial membrane and is involved in the formation of the mitochondrial respiratory chain III. It has also been suggested that this protein plays a role in cytokinesis. Mutations in this gene cause mitochondrial complex III deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2012] Transcript Variant: This variant (1) represents the shorter transcript but encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC113938 | TTC19 (untagged)-Human tetratricopeptide repeat domain 19 (TTC19), transcript variant 1 |
USD 760.00 |
|
RC211271 | TTC19 (Myc-DDK-tagged)-Human tetratricopeptide repeat domain 19 (TTC19), transcript variant 1 |
USD 420.00 |
|
RG211271 | TTC19 (GFP-tagged) - Human tetratricopeptide repeat domain 19 (TTC19), transcript variant 1 |
USD 460.00 |
|
RC211271L1 | Lenti ORF clone of Human tetratricopeptide repeat domain 19 (TTC19), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC211271L2 | Lenti ORF clone of Human tetratricopeptide repeat domain 19 (TTC19), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC211271L3 | Lenti ORF clone of Human tetratricopeptide repeat domain 19 (TTC19), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC211271L4 | Lenti ORF clone of Human tetratricopeptide repeat domain 19 (TTC19), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review