IGF1 (NM_001111285) Human Untagged Clone

CAT#: SC318794

IGF1 (untagged)-Human insulin-like growth factor 1 (somatomedin C) (IGF1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IGF1
• Synonyms: IGF; IGF-I; IGFI; MGF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001111285, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGAAAAATCAGCAGTCTTCCAACCCAATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGTGAAGA
  TGCACACCATGTCCTCCTCGCATCTCTTCTACCTGGCGCTGTGCCTGCTCACCTTCACCAGCTCTGCCAC
  GGCTGGACCGGAGACGCTCTGCGGGGCTGAGCTGGTGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGC
  TTTTATTTCAACAAGCCCACAGGGTATGGCTCCAGCAGTCGGAGGGCGCCTCAGACAGGCATCGTGGATG
  AGTGCTGCTTCCGGAGCTGTGATCTAAGGAGGCTGGAGATGTATTGCGCACCCCTCAAGCCTGCCAAGTC
  AGCTCGCTCTGTCCGTGCCCAGCGCCACACCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACC
  AACAAGAACACGAAGTCTCAGAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGG
  GGACAGAAGCAAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAGAAATGC
  TGAATGCAGAGGCAAAAAAGGAAAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001111285
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001111285.1, NP_001104755.1
• RefSeq Size: 949 bp
• RefSeq ORF: 588 bp
• Locus ID: 3479
• Cytogenetics: 12q23.2
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein
• Protein Pathways: Dilated cardiomyopathy, Focal adhesion, Glioma, Hypertrophic cardiomyopathy (HCM), Long-term depression, Melanoma, mTOR signaling pathway, Oocyte meiosis, p53 signaling pathway, Pathways in cancer, Progesterone-mediated oocyte maturation, Prostate cancer
• Gene Summary: 'The protein encoded by this gene is similar to insulin in function and structure and is a member of a family of proteins involved in mediating growth and development. The encoded protein is processed from a precursor, bound by a specific receptor, and secreted. Defects in this gene are a cause of insulin-like growth factor I deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]'
  Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR, compared to variant 1, resulting in a protein (isoform 3) with a novel C-terminus, compared to isoform 1. This isoform is also known as IB. Sequence Note: This RefSeq was created from transcript and genomic sequence because transcript sequence consistent with the reference assembly was not available for all regions of the RefSeq transcript. The extent of this transcript is supported by transcript alignments.