NACA (NM_001113201) Human Untagged Clone

CAT#: SC318799

NACA (untagged)-Human nascent polypeptide-associated complex alpha subunit (NACA), transcript variant 2


  "NM_001113201" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NACA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NACA
Synonyms HSD48; NAC-alpha; NACA1; skNAC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001113201, the custom clone sequence may differ by one or more nucleotides


ATGCCCGGCGAAGCCACAGAAACCGTCCCTGCTACAGAGCAGGAGTTGCCGCAGCCCCAGGCTGAGACAG
GGTCTGGAACAGAATCTGACAGTGATGAATCAGTACCAGAGCTTGAAGAACAGGATTCCACCCAGGCAAC
CACACAACAAGCCCAGCTGGCGGCAGCAGCTGAAATTGATGAAGAACCAGTCAGTAAAGCAAAACAGAGT
CGGAGTGAAAAGAAGGCACGGAAGGCTATGTCCAAACTGGGTCTTCGGCAGGTTACAGGAGTTACTAGAG
TCACTATCCGGAAATCTAAGAATATCCTCTTTGTCATCACAAAACCAGATGTCTACAAGAGCCCTGCTTC
AGATACTTACATAGTTTTTGGGGAAGCCAAGATCGAAGATTTATCCCAGCAAGCACAACTAGCAGCTGCT
GAGAAATTCAAAGTTCAAGGTGAAGCTGTCTCAAACATTCAAGAAAACACACAGACTCCAACTGTACAAG
AGGAGAGTGAAGAGGAAGAGGTCGATGAAACAGGTGTAGAAGTTAAGGACATTGAATTGGTCATGTCACA
AGCAAATGTGTCGAGAGCAAAGGCAGTCCGAGCCCTGAAGAACAACAGTAATGATATTGTAAATGCGATT
ATGGAATTAACAATGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001113201
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001113201.2, NP_001106672.1
RefSeq Size 1138 bp
RefSeq ORF 648 bp
Locus ID 4666
Cytogenetics 12q13.3
Protein Families Druggable Genome, Transcription Factors
Gene Summary 'This gene encodes a protein that associates with basic transcription factor 3 (BTF3) to form the nascent polypeptide-associated complex (NAC). This complex binds to nascent proteins that lack a signal peptide motif as they emerge from the ribosome, blocking interaction with the signal recognition particle (SRP) and preventing mistranslocation to the endoplasmic reticulum. This protein is an IgE autoantigen in atopic dermatitis patients. Alternative splicing results in multiple transcript variants, but the full length nature of some of these variants, including those encoding very large proteins, has not been determined. There are multiple pseudogenes of this gene on different chromosomes. [provided by RefSeq, Feb 2016]'
Transcript Variant: This variant (2) contains multiple differences in the 5' UTR and lacks three alternate exons in the central coding region, but maintains the reading frame, compared to variant 1. This variant encodes isoform b, which is shorter than isoform a. Variants 2, 3, 4, and 5, encode the same isoform (b).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.