FOLR2 (NM_001113536) Human Untagged Clone

CAT#: SC318807

FOLR2 (untagged)-Human folate receptor 2 (fetal) (FOLR2), transcript variant 4


  "NM_001113536" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "FOLR2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FOLR2
Synonyms BETA-HFR; FBP; FBP/PL-1; FR-BETA; FR-P3; FRbeta
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001113536, the custom clone sequence may differ by one or more nucleotides
ATGGTCTGGAAATGGATGCCACTTCTGCTGCTTCTGGTCTGTGTAGCCACCATGTGCAGT
GCCCAGGACAGGACTGATCTCCTCAATGTCTGTATGGATGCCAAGCACCACAAGACAAAG
CCAGGTCCTGAGGACAAGCTGCATGACCAATGCAGTCCCTGGAAGAAGAATGCCTGCTGC
ACAGCCAGCACCAGCCAGGAGCTGCACAAGGACACCTCCCGCCTGTACAACTTTAACTGG
GACCACTGCGGCAAGATGGAGCCCGCCTGCAAGCGCCACTTCATCCAGGACACCTGTCTC
TATGAGTGCTCACCCAACCTGGGGCCCTGGATCCAGCAGGTGAATCAGAGCTGGCGCAAA
GAACGCTTCCTGGATGTGCCCTTATGCAAAGAGGACTGTCAGCGCTGGTGGGAGGATTGT
CACACCTCCCACACGTGCAAGAGCAACTGGCACAGAGGATGGGACTGGACCTCAGGAGTT
AACAAGTGCCCAGCTGGGGCTCTCTGCCGCACCTTTGAGTCCTACTTCCCCACTCCAGCT
GCCCTTTGTGAAGGCCTCTGGAGTCACTCATACAAGGTCAGCAACTACAGCCGAGGGAGC
GGCCGCTGCATCCAGATGTGGTTTGATTCAGCCCAGGGCAACCCCAACGAGGAAGTGGCG
AGGTTCTATGCTGCAGCCATGCATGTGAATGCTGGTGAGATGCTTCATGGGACTGGGGGT
CTCCTGCTCAGTCTGGCCCTGATGCTGCAACTCTGGCTCCTTGGC
Restriction Sites Please inquire     
ACCN NM_001113536
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001113536.1, NP_001107008.1
RefSeq Size 1127 bp
RefSeq ORF 768 bp
Locus ID 2350
Cytogenetics 11q13.4
Protein Families Druggable Genome, Secreted Protein
Gene Summary 'The protein encoded by this gene is a member of the folate receptor (FOLR) family, and these genes exist in a cluster on chromosome 11. Members of this gene family have a high affinity for folic acid and for several reduced folic acid derivatives, and they mediate delivery of 5-methyltetrahydrofolate to the interior of cells. This protein has a 68% and 79% sequence homology with the FOLR1 and FOLR3 proteins, respectively. Although this protein was originally thought to be specific to placenta, it can also exist in other tissues, and it may play a role in the transport of methotrexate in synovial macrophages in rheumatoid arthritis patients. Multiple transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. All variants (1-4) encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.