p57 Kip2 (CDKN1C) (NM_001122631) Human Untagged Clone

CAT#: SC318825

CDKN1C (untagged)-Human cyclin-dependent kinase inhibitor 1C (p57, Kip2) (CDKN1C), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CDKN1C
• Synonyms: BWCR; BWS; KIP2; p57; p57Kip2; WBS
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001122631, the custom clone sequence may differ by one or more nucleotides
  ATGGAGCGTCTTGTCGCCCGTGGGACCTTCCCAGTACTAGTGCGCACCAGCGCCTGCCGC
  AGCCTCTTCGGGCCGGTGGACCACGAGGAGCTGAGCCGCGAGCTGCAGGCCCGCCTGGCC
  GAGCTGAACGCCGAGGACCAGAACCGCTGGGATTACGACTTCCAGCAGGACATGCCGCTG
  CGGGGCCCTGGACGCCTGCAGTGGACCGAAGTGGACAGCGACTCGGTGCCCGCGTTCTAC
  CGCGAGACGGTGCAGGTGGGGCGCTGCCGCCTGCTGCTGGCGCCGCGGCCCGTCGCGGTC
  GCGGTGGCTGTCAGCCCGCCCCTCGAGCCGGCCGCTGAGTCCCTCGACGGCCTCGAGGAG
  GCGCCGGAGCAGCTGCCTAGTGTCCCGGTCCCGGCCCCGGCGTCCACCCCGCCCCCAGTC
  CCGGTCCTGGCTCCAGCCCCGGCCCCGGCTCCGGCTCCGGTCGCGGCTCCGGTCGCGGCT
  CCGGTCGCGGTCGCGGTCCTGGCCCCGGCCCCGGCCCCGGCTCCGGCTCCGGCTCCGGCC
  CCGGCTCCAGTCGCGGCCCCGGCCCCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCCCGCC
  CCGGCCCCGGCCCCGGACGCGGCGCCTCAAGAGAGCGCCGAGCAGGGCGCGAACCAGGGG
  CAGCGCGGCCAGGAGCCTCTCGCTGACCAGCTGCACTCGGGGATTTCGGGACGTCCCGCG
  GCCGGCACCGCGGCCGCCAGCGCCAACGGCGCGGCGATCAAGAAGCTGTCCGGGCCTCTG
  ATCTCCGATTTCTTCGCCAAGCGCAAGAGATCAGCGCCTGAGAAGTCGTCGGGCGATGTC
  CCCGCGCCGTGTCCCTCTCCAAGCGCCGCCCCTGGCGTGGGCTCGGTGGAGCAGACCCCG
  CGCAAGAGGCTGCGG
  
• Restriction Sites: Please inquire
• ACCN: NM_001122631
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001122631.1, NP_001116103.1
• RefSeq Size: 1771 bp
• RefSeq ORF: 918 bp
• Locus ID: 1028
• Cytogenetics: 11p15.4
• Protein Families: Druggable Genome
• Protein Pathways: Cell cycle
• Gene Summary: 'This gene is imprinted, with preferential expression of the maternal allele. The encoded protein is a tight-binding, strong inhibitor of several G1 cyclin/Cdk complexes and a negative regulator of cell proliferation. Mutations in this gene are implicated in sporadic cancers and Beckwith-Wiedemann syndorome, suggesting that this gene is a tumor suppressor candidate. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]'
  Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence and uses an alternate splice junction in the 3' UTR compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2 and 3 both encode isoform b.